You are seeing this message because your Web browser does not support basic Web standards. Find out more about why this message is appearing and what you can do to make your experience on this site better.


ABOUT ARCHIVES
Advanced Search

Welcome   | My Account | E-mail Alerts | RSS | Access Rights | Sign In


  Vol. 128 No. 6, June 2010 TABLE OF CONTENTS
  Online Only
 •  Online First Table of
Contents
  Laboratory Sciences
 •Online Features
 This Article
 •Abstract
 •PDF
 • Reply to article
 •Send to a friend
 • Save in My Folder
 •Save to citation manager
 •Permissions
 Citing Articles
 •Citation map
 •Citing articles on HighWire
 •Citing articles on Web of Science (8)
 •Contact me when this article is cited
 Related Content
 •Similar articles in this journal
 Topic Collections
 •Glaucoma
 •Genetics
 •Genetic Disorders
 •Genetics, Other
 •Alert me on articles by topic
 Social Bookmarking
  Add to CiteULike Add to Connotea Add to Delicious Add to Digg Add to Facebook Add to Reddit Add to Technorati Add to Twitter What's this?

Mitochondrial Damage in the Trabecular Meshwork of Patients With Glaucoma

Alberto Izzotti, MD, PhD; Sergio C. Saccà, MD; Mariagrazia Longobardi, PhD; Cristina Cartiglia, PhD

Arch Ophthalmol. 2010;128(6):724-730.

ABSTRACT



Objectives  To analyze the frequency of mitochondrial DNA (mtDNA) damage in patients with primary open-angle glaucoma. Oxidative damage plays a major role in glaucoma pathogenesis. Since no environmental risk factor for glaucoma is recognized, we focused our attention on mitochondria, the main endogenous source of reactive oxygen species.

Methods  Mitochondrial damage was evaluated analyzing a common mtDNA deletion by real-time polymerase chain reaction in trabecular meshwork collected at surgery from 79 patients with primary open-angle glaucoma and 156 unaffected matched controls. In the same samples, polymorphisms of genes encoding for antioxidant defenses (GSTM1), repair of oxidative DNA damage (OGG1), and apoptosis (FAS) were tested.

Results  Mitochondrial DNA deletion was dramatically increased (5.32-fold; P = .01) in trabecular meshwork of patients with glaucoma vs controls. This finding was paralleled by a decrease in the number of mitochondria per cell (4.83-fold; P < .001) and by cell loss (16.36-fold; P < .01). Patients with glaucoma bearing the GSTM1-null genotype showed increased amounts of mtDNA deletion and a decreased number of mitochondria per cell as compared with GSTM1-positive subjects. Patients bearing a FAS homozygous mutation showed only a decreased number of mitochondria per cell.

Conclusions  Obtained results indicate that mitochondrion is targeted by the glaucomatous pathogenic processes. Some subjects bearing adverse genetic assets are more susceptible to this event.

Clinical Relevance  Oxidative damage to the trabecular meshwork exerts a pathogenic role in glaucoma inducing mitochondrial damage and triggering apoptosis and cell loss. This issue may be useful to develop new glaucoma molecular biomarkers and to identify high-risk subjects.



INTRODUCTION


 Jump to Section
 •Top
 •Introduction
 •Methods
 •Results
 •Comment
 •Author information
 •References

The trabecular meshwork (TM) is a key region for the initiation of glaucoma, the main cause of irreversible blindness worldwide. This tissue provides the conventional aqueous humor outflow from the anterior chamber. The functional impairment of TM leads to dysfunction of the outflow pathway1 and triggers glaucoma pathogenesis. The progressive loss of TM cells observed in patients with glaucoma has been attributed to the long-term effect of oxidative free radicals.2-3 Reactive oxygen species are able to alter TM function.4-5 Accordingly, the intraocular pressure (IOP) increase, characterizing most glaucomas, is related to oxidatively induced degenerative processes affecting TM. Oxidative stress plays a role in glaucoma development initially by damaging TM cells, then altering nitric oxide and endothelin homeostasis, and finally contributing to ganglional cell death.6

Although much experimental evidence indicates that oxidative damage is implicated in the pathogenesis of primary open-angle glaucoma (POAG), the source of such damage remains to be identified. No environmental sources of oxidative stress, such as cigarette smoke or radiation, have been involved in glaucoma pathogenesis.7 Mitochondria are the most important endogenous source of reactive oxygen species in cells.8 Mitochondria possess their own genetic material, the mitochondrial DNA (mtDNA), a circular double-strand DNA lacking nucleosomal structure and DNA repair systems. These features make mtDNA particularly susceptible to damage induced by reactive oxygen species, which causes mitochondrial failure and increased endogenous production of oxidative damaging species, thus establishing a "vicious cycle."9

Mitochondrial damage is involved in the pathogenesis of many chronic degenerative diseases. Some experimental findings suggest a possible role of mitochondrial damage in POAG, which, however, still remains to be demonstrated.10-11 A common marker of mtDNA damage associated with oxidative stress is the 4977–base pair (bp) common deletion (mtDNA4977),9 involving the loss of more than one-fourth of the whole mitochondrial genome, disrupting 3 complexes of genes coding for proteins involved in oxidative phosphorylation.12

The aim of our study was to analyze the frequency of mtDNA4977 in patients with POAG vs controls to evaluate the role of mitochondrial dysfunction in the glaucomatous TM. This end point was analyzed in the iris of the same patients to evaluate the peculiar susceptibility of TM to oxidative stress as compared with other anterior chamber tissues. This issue is relevant because we recently demonstrated that TM is the most sensitive tissue to in vitro oxidative stress in the anterior chamber.13

The quantification of mtDNA4977 was carried out by quantitative polymerase chain reaction (QPCR), which is highly sensitive and reliable as confirmed by the increasing number of articles using this method.14-15

Insofar, evidence demonstrating the purported role of mitochondrial damage in POAG pathogenesis is overwhelming, but most results were not obtained using POAG target tissue, ie, the TM. Our study provides for the first time, to our knowledge, evidence that mitochondrial damage really occurs in the TM of patients with glaucoma, thus providing evidence for its pathogenic role in glaucoma.

Genetic factors predispose to POAG development. However, glaucomas caused by single gene mutations are extremely rare. The most relevant POAG-related mutations are those occurring in MYOC and OPTN, which occur in less than 3% of POAG.16 MYOC was demonstrated to be a structural component of the mitochondrial wall, further suggesting an important role of mitochondrial damage in POAG-related TM degeneration.17

Accordingly, the analysis of genetic risk factors should be also focused on genetic polymorphisms conferring a moderate risk but widely spread in the population. On this basis, we decided to analyze the role of frequent genetic polymorphisms as possible contributors to the mtDNA damage occurring in glaucomatous TM. Selected genes included (1) glutathione S-transferase 1 (GSTM1), coding a protein involved in the scavenging of reactive oxygen radicals18; (2) 8-oxo-guanine glycosylase 1 (OGG1), coding a protein repairing 8-oxo-2'-deoxyguanosine, the main oxidative DNA lesions increased in the TM of patients with POAG19; and (3) FAS, coding a protein involved in the activation of the apoptotic cascade.20

GSTM1 represents a pivotal intracellular defense against oxidative stress and its homozygous deletion has been associated with an increased level of oxidative DNA damage in TM.19 Accordingly, a GSTM1 polymorphism has been proposed as a possible risk factor for glaucoma, although other studies did not confirm this finding.21-22 OGG1 adverse polymorphisms inducing failure in its repairing ability have been related to increased sensitivity to oxidative damage, resulting in cell death.23 FAS polymorphisms modulate cell attitude to undergo apoptosis as a consequence of oxidative stress.20 The goal of our study was to analyze the interaction between mtDNA damage, genetic polymorphisms, and POAG.


METHODS


 Jump to Section
 •Top
 •Introduction
 •Methods
 •Results
 •Comment
 •Author information
 •References

SUBJECT RECRUITMENT AND SAMPLE COLLECTION

The study had a case-control design. Recruited cases had POAG requiring surgical intervention. Inclusion criterion for cases was the presence of POAG with no tonometric compensation established by clinical and instrumental examinations, as elsewhere reported.19 Main elements for POAG diagnosis were papilla morphology, IOP values, and visual field analysis.

Exclusion criterion was the presence of any other ocular, systemic, or neurological diseases other than POAG-related optic nerve damage. An additional exclusion criterion was the presence of any glaucoma types other than POAG. The TM samples were collected by standard surgical trabeculectomy, as previously reported.2, 19 All the enrolled patients furnished an informed written consent and were treated in accordance with the Declaration of Helsinki.

Trabeculectomy specimens were collected from 79 patients with glaucoma, including 49 women and 30 men, mean (SE) age, 66.4 (2.19) years. All patients had an elevated IOP (minimum, 23 mm Hg; maximum, 36 mm Hg; mean [SE], 27.8 [3.69] mm Hg). Specificity of TM alterations was examined by analyzing the iris in a subgroup of 19 patients.

For control samples, we used trabeculectomy specimens collected from 156 subjects, mean (SE) age, 65.1 (1.17) years and sex matched with cases. Samples were collected from glaucoma-free cornea donors by the Melvin Jones Eye Bank, as previously reported.19

Sample collection from controls was performed no later than 1 hour after death, thus ensuring cell viability, as necessary for the corneal transplant. Samples were immersed in stabilizing buffers containing antioxidants and stored in a deep freezer (–80°C). DNA purification was performed by incubating samples with proteinase K followed by solvent extraction in an oxygen-free atmosphere.19

DETECTION OF mtDNA4977 DELETION AND mtDNA COPY NUMBER

Quantification of mtDNA4977 deletion and total mtDNA were performed by real-time PCR (QPCR) using fluorescent probes (Figure 1). Two QPCR reactions were performed in parallel for each sample, the first to detect the amount of total mtDNA, the second to quantify mtDNA4977 deletion. The total mtDNA reaction was carried out using 2 primers (total mtDNA sense: CCATCTTTGCAGGCACACTCATC and total mtDNA antisense: ATCCACCTCAACTGCCTGCTATG) flanking a sequence of mtDNA (474 bp) known not to be susceptible to the deletion24 and an ad hoc–designed FAM-labeled molecular beacon (total mtDNA: 5'-FAM-CGCGATCTCACGCAAGCAACCGCATCCATGATCGCG-BHQ1-3'). The mtDNA4977 deletion reaction was performed using 2 primers (deleted mtDNA sense: GGCCCGTATTTACCCTATAG and deleted mtDNA antisense: GGTGAGAAGAATTATTCGAGTG) recognizing mtDNA regions flanking the deletion site plus a molecular FAM-labeled beacon (deleted mtDNA: 5'-FAM-CGCGATCCAGCCTAGCATTAGCAGGAATACCTTGATCGCG-BHQ1-3') targeting a DNA sequence between the 2 primers and ahead of the deletion site. Because of the short elongation time, only deleted mtDNA can efficiently produce amplicons (ie, double-strand DNA 400 bp) containing the target sequence for the deleted mtDNA molecular beacon.


Figure 1
View larger version (63K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 1. Evaluation of the 4977–base pair mitochondrial DNA (mtDNA4977) deletion and mtDNA copy number by real-time quantitative polymerase chain reaction in the trabecular meshwork. Molecular beacon probes emit fluorescent light only when the deletion of mtDNA is present.


A Basic Local Alignment Search Tool search for the deleted mtDNA amplicon and probe were performed with high specificity. The stringent conditions of the reaction are a further warrant for specificity. The incidental cross-reaction of the probe with genomic DNA was further assumed as negligible because mtDNA presents in each cell in multiple copy as compared with nuclear DNA (nDNA).

The reaction conditions were 5 µL of 10x PCR buffer, 0.4 µL of 100mM dNTP mix, 2 µL of 50mM magnesium chloride, 0.5 µL of platinum Taq polymerase (Invitrogen Corp, Carlsbad, California), 37.1 µL of sterile water, 1 µL of 10µM sense primer, 1 µL of 10µM antisense primer, 2 µL of molecular beacon, and 1 µL of DNA (25 ng).

The QPCR reactions were performed in a rotating real-time thermocycler (Rotorgene3000; Corbett Life Science, Sydney, Australia), using the following temperature ramp: 94°C for 2 minutes followed by 45 cycles at 94° for 30 seconds, annealing temperature of 54°C for total mtDNA and 51°C for deleted mtDNA for 30 seconds, and 72°C for 30 seconds. Fluorescence was acquired at the end of each annealing step. Each sample was tested in duplicate.

The reaction efficacies for the total mtDNA and mtDNA4977 deletion quantifications were assayed and the results were 0.73 and 0.78, respectively. An internal control was tested in each reaction and the results were expressed as relative quantity (sample/internal control). The specificity of the amplification product and the results were confirmed by capillary electrophoresis using the Agilent 2100 Bioanalyzer with a DNA 1000 Series II kit (Agilent Technologies, Waldbronn, Germany), thereby confirming QPCR results by capillary electrophoresis of amplified mtDNA sequences.

The relative ratio of deleted mtDNA to total mtDNA was assessed for each sample and normalized for cell number assayed quantifying by QPCR the housekeeping gene GAPDH. The amount of mtDNA4977 deletion was expressed as percentage of total mtDNA.

EVALUATION OF THE nDNA:mtDNA RATIO

The relative amount of total nDNA in each sample was evaluated by quantifying the copies of GAPDH by QPCR. This parameter was related both to mtDNA copy number (nDNA:mtDNA ratio) and to the amount of wet tissue processed (DNA per milligram of wet tissue). This last parameter was assumed as an indicator of cell number in TM.

GENETIC POLYMORPHISM ANALYSES

Genetic polymorphisms were analyzed in an aliquot (0.1 µg) of nDNA as purified from TM samples. The OGG1 Ser326Cys polymorphism, resulting from a C>G transversion in exon 7, was evaluated as previously described by QPCR using a pair of gene-specific molecular beacons to discriminate between the occurrence of this genetic variant on both alleles (homozygous mutant), 1 allele only (heterozygous), or no allele (wild type).25 The FAS promoter 670 polymorphism, resulting from an A/G substitution at the 670 nucleotide position in the enhancer region of the gene, was evaluated by QPCR using a set of gene-specific molecular beacons to distinguish the occurrence of this genetic variant on both alleles (homozygous mutant), 1 allele only (heterozygous), or no allele (wild type).

Molecular beacon sequences were human FAS wild type: 5'-FAS-CGCGATCTGTCCATTCCAGAAACGTCTGTGAGCGATCGCG-BHQ1-3' and human FAS mtDNA: 5'-HEX-CGCGATCTGTCCATTCCAGGAACGTCTGTGAGCGATCGCG-BHQ-3'. The PCR primer sequences were human FAS sense: 5'-CCCTTTTCAGAGCCCTATGG-3' and human FAS antisense: 5'-TGCTGGAGTCACTCAGAGAAAG-3'. The reaction was performed at 94°C for 2 minutes, followed by 45 cycles at 94°C for 30 seconds, 66°C for 15 seconds, 64°C for 15 seconds, 53°C for 30 seconds, and 72°C for 30 seconds. The HEX signal was acquired at the end of the 66°C step and FAM signal, at the end of the 64°C step.

The GSTM1 polymorphism, including the gene presence on 1 or both alleles (positive) or its homozygous deletion (null), was investigated by QPCR as previously described.25 All primer sequences and PCR conditions were determined using Beacon Designer software (Premier Biosoft International, Palo Alto, California) purchased from TIB Molbiol (Berlin, Germany).

STATISTICAL ANALYSES

Comparisons among quantitative variables in different groups of patients were executed by analysis of variance and t test for unpaired data after checking the normality of the distribution by skew kurtosis analysis. The accepted level of significance in all cases was P < .05. In situations without a normal distribution of data, a nonparametric test was used (Mann-Whitney U test and Kruskal-Wallis test). Correlations between continuous variables were tested by linear regression analysis. Differences of frequency distributions among nominal variables were tested by {chi}2 test. All statistical analyses were performed using Statview software (Abacus Concept, Berkeley, California).


RESULTS


 Jump to Section
 •Top
 •Introduction
 •Methods
 •Results
 •Comment
 •Author information
 •References

mtDNA COPY NUMBER AND mtDNA4977 DELETION IN TM OF PATIENTS WITH POAG VS CONTROLS

A remarkably high level of molecular damage was detected in mtDNA in the TM of patients with POAG as compared with unaffected controls. In particular, there was a statistically significant 5.32-fold increase in the level of mtDNA4977 deletion in the TM of patients with glaucoma as compared with controls (Table 1). These data were confirmed by capillary electrophoresis, resulting a 1.7-fold increase in the level of mtDNA4977 deletion in the TM of patients with glaucoma as compared with controls (Figure 2). Furthermore, the results were validated performing the same analysis on mtDNA as purified from isolated mitochondria (Mitochondrial Isolation Kit; Pierce, Rockford, Illinois) collected from the same tissue.


View this table:
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Table 1. mtDNA Damage in TM as Detected in 79 Patients With POAG and 156 Controls



Figure 2
View larger version (26K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 2. Electropherogram of the amplification products. A, The peak at elution time 95 seconds corresponds to the 474–base pair (bp) tract of mitochondrial DNA (mtDNA) not susceptible to deletion. B, The peak at elution time 90 seconds corresponds to the 400-bp amplicon flanking the deletion site. The blue line corresponds to a control sample and the red line, to a primary open-angle glaucoma (POAG) sample. Part A shows that the amount of mtDNA in both samples was the same (the curves overlap perfectly). Part B shows that the deletion amount is higher in the POAG sample than in the control sample (red peak higher than the blue one).


The variability of the results obtained in cases was remarkable and cannot be attributed to interexperimental variability, which fell lower than 30% when replicate samples were analyzed. Nevertheless, the difference in mtDNA4977 levels as detected in controls and cases was remarkable and statistically significant (P = .01).

Furthermore, both the amount of mtDNA (4.83-fold) and the nDNA per milligram of wet tissue ratio (16.36-fold) were reduced in glaucomatous TM (Table 1). This decrease of the nDNA per milligram of wet tissue ratio indicates the occurrence of a dramatic drop in cell number in the TM. This finding was paralleled by a rising incidence of mtDNA damage, as indicated by the increase in mtDNA deletion and the decrease in mtDNA copy number per cell.

A negative correlation between age and mtDNA:nDNA ratio was observed in controls (r = –0.192; P < .05) but not in patients with POAG (r = –0.069; P = .27).

TM VS IRIS COMPARISON IN PATIENTS WITH POAG

Mitochondrial loss and damage observed in patients with POAG selectively occurred only in the TM and not in the iris. In fact, mtDNA deletions were significantly higher in the TM than in the iris of the same patients, while mtDNA copy number and mtDNA:nDNA ratio were significantly decreased in the TM as compared with the iris. Finally, the nDNA per milligram of wet tissue ratio was lower in the TM than in the iris, a finding amenable to the different cellularity of these tissues (Table 2).


View this table:
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Table 2. mtDNA Damage as Evaluated in Parallel in the TM and Iris of the Same 19 Patients With POAG


FREQUENCIES OF GENETIC POLYMORPHISMS

The percentages of various polymorphisms as analyzed in patients with POAG and controls are reported in Table 3. None of these differences was statistically significant except an increased frequency of the GSTM1-null genotype in patients with POAG as compared with controls. By comparison, the frequency of the various genotypes as detected for each gene in the general population is reported (Table 3).


View this table:
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Table 3. Frequency of Analyzed Genetic Polymorphisms in Patients With Glaucoma, Controls, and the General Population as Inferred From Available Literature


INFLUENCES OF GENETIC POLYMORPHISMS ON MITOCHONDRIAL DAMAGE

OGG1 polymorphisms did not exert any significant influence on any of the molecular end points tested (Table 3). The GSTM1 homozygous deletion was associated with an increased level of mtDNA deletion (1.7-fold) and a decreased amount of total mtDNA (2.5-fold) and mtDNA:nDNA ratio (2.3-fold). Conversely, the amount of nDNA per milligram of wet tissue was not affected (Table 3). The FAS homozygous mutation was significantly correlated both with a decreased amount of mtDNA (2.3-fold) and mtDNA:nDNA ratio (3.2-fold). Conversely, no effect of this mutation was detected on the amounts of deleted mtDNA and nDNA per milligram of wet tissue (Table 3).

RELATIONSHIPS AMONG MOLECULAR END POINTS

The correlation between the mtDNA deletion and the mtDNA:nDNA ratio was not significant in controls (r = 0.090; P = .25) but was of borderline statistical significance in patients with glaucoma (r = –0.277; P = .06). These results indicate that mtDNA deletion is inversely related to the decrease of mtDNA copy number in patients with glaucoma but not in controls. No correlation was observed among the other molecular end points tested in controls or patients with glaucoma.


COMMENT


 Jump to Section
 •Top
 •Introduction
 •Methods
 •Results
 •Comment
 •Author information
 •References

Though many studies in the literature analyze mitochondrial dysfunction in POAG, most of them were carried out on surrogate tissue (Table 4). To the best of our knowledge, our study is the largest study performed analyzing genetic polymorphisms and molecular alterations directly in TM.


View this table:
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Table 4. Mitochondrial Dysfunction in TM and Surrogate Tissues of Patients With Glaucomaa


Our study provides evidence that mtDNA damage occurs in the target tissue of POAG, the TM. Such damage is detectable only in the TM and not in other anterior chamber districts, eg, the iris. Genetic polymorphisms affect the amount of mtDNA damage in TM.

The level of mtDNA4977 detected in glaucomatous TM is remarkably high. By comparison, the level of mtDNA4977 as detected by our group using the herein-reported QPCR method in stemlike mammary cells spanned from 0.9% to 2.1% only.35 Markaryan et al15 detected a similar range of molecular lesions in different tissues of cochlear structures using the same method.

The high interindividual variation in the level of mtDNA4977, especially in patients with POAG, could be due to some still unidentified genetic polymorphisms or to the variability in the dietary intake of antioxidants. It is unlikely that such variability could be due to differences in diseases status because all patients were carriers of advanced unbalanced POAG requiring surgical trabeculectomy. Other variables possibly contributing to this variability might be related to mitochondrial haplotypes, which are characterized by different sensitivity to oxidative damage and undergo interindividual variations.36 However, to our knowledge, no direct relationship between mtDNA haplotypes and POAG prevalence has been reported.37

A further explanation for the high variability of mtDNA deletion observed in POAG may be due to the low amount of mtDNA detected that affects PCR amplification conditions requiring many amplification cycles.

Our findings shed light on mechanisms contributing to TM degeneration in POAG. In cases of oxidative stress, mitochondrial damage triggers apoptosis.38-39 These mechanisms result in degenerative phenomena in tissues composed of perennial cells, such as TM.

Our results are in agreement with previous studies performed in vitro in TM primary cultures collected from patients with POAG and donor eyes, indicating that in POAG mitochondrial dysfunction results in intracellular calcium and oxidative overload.30 Primary open-angle glaucoma–related mitochondrial alterations detected in vitro include lower adenosine triphosphate production and decreased transmembrane potential resulting in mitochondrial complex I defect associated with the degeneration of TM cells.11 The occurrence of mitochondrial functional defects in glaucomatous TM cells resulting in abnormal vulnerability to intracellular calcium increase has been reported.38

Mitochondrial haplogroups have been examined as a possible genetic factor for glaucoma. No association between mitochondrial haplogroups and POAG has been reported, although a possible association with primary angle-closure glaucoma has been reported in a small study.37, 40

Mitochondrial damage and loss occurring in TM trigger both degenerative and apoptotic phenomena resulting in cell loss. This cell loss clinically manifests as IOP increase. Decrease of TM cellularity during glaucoma course has been previously reported, although to a lesser extent than those indicated by our results.41 Changes in TM composition during glaucoma course could contribute to the detected decrease of the DNA per millgram of wet tissue ratio.

The TM specificity of mtDNA damage in POAG is supported by the comparison with the iris of the same patients with POAG in whom such damage was not detected. This comparison was performed between 2 neighbor tissues of the anterior chamber, thus being highly specific. The lack of mtDNA damage in tissues different from TM is in agreement with the negative findings reported by other studies in blood lymphocytes of patients with POAG.42

A comparison of mitochondrial damage and genetic polymorphisms does not support a major role for OGG1 in POAG. Conversely, both GSTM1 and FAS appear to affect molecular damage occurring in TM of patients with POAG. Patients devoid of GSTM1 activity have increased mtDNA deletion. This finding may be interpreted as resulting from the decreased antioxidant defenses observed in subjects with GSTM1 deletion, demonstrated by the increased TM oxidative DNA damage in the GSTM1-null vs GSTM1-positive patients with POAG.19

FAS homozygous mutations did not exert an influence on the level of mtDNA deletion while decreasing the mtDNA copy number and the mtDNA:nDNA ratio. In the anterior chamber of the eye, FAS has been demonstrated to provoke apoptosis increasing myocilin release from mitochondria to cytosolic compartments of TM cells.31 Further studies are required to clarify in which glaucoma types, other than POAG, high levels of mtDNA deletion occur in TM.

In conclusion, our results indicate that patients with POAG bear genetic predisposition to oxidative stress contributing to mtDNA damage and apoptosis. Mitochondrial DNA deletion is a severe damage transmitted during mitochondrial mitosis to new mitochondrial progeny. Accordingly, mitochondrial damage progressively increases with age. On this basis, POAG may be interpreted as a mitochondriopathy affecting TM cells, thus hampering aqueous humor outflow.


AUTHOR INFORMATION


 Jump to Section
 •Top
 •Introduction
 •Methods
 •Results
 •Comment
 •Author information
 •References

Correspondence: Alberto Izzotti, MD, PhD, Department of Health Sciences, University of Genoa, Via Pastore 1, I-16132 Genoa, Italy (izzotti{at}unige.it).

Submitted for Publication: August 18, 2009; final revision received October 15, 2009; accepted November 25, 2009.

Author Contributions: Dr Izzotti had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.

Financial Disclosure: None reported.

Funding/Support: This study was supported by the Glaucoma Foundation.

Author Affiliations: Department of Health Sciences, University of Genoa (Drs Izzotti, Longobardi, and Cartiglia), and Ophthalmology Unit, St. Martino Hospital (Dr Saccà), Genoa, Italy.


REFERENCES


 Jump to Section
 •Top
 •Introduction
 •Methods
 •Results
 •Comment
 •Author information
 •References

1. Alvarado JA, Yeh RF, Franse-Carman L, Marcellino G, Brownstein MJ. Interactions between endothelia of the trabecular meshwork and of Schlemm's canal: a new insight into the regulation of aqueous outflow in the eye. Trans Am Ophthalmol Soc. 2005;103:148-162, discussion 162-163. PUBMED
2. Alvarado J, Murphy CG, Juster R. Trabecular meshwork cellularity in primary open-angle glaucoma and nonglaucomatous normals. Ophthalmology. 1984;91(6):564-579. WEB OF SCIENCE | PUBMED
3. Saccà SC, Pascotto A, Camicione P, Capris P, Izzotti A. Oxidative DNA damage in the human trabecular meshwork: clinical correlation in patients with primary open-angle glaucoma. Arch Ophthalmol. 2005;123(4):458-463. FREE FULL TEXT
4. Zhou L, Li Y, Yue BY. Oxidative stress affects cytoskeletal structure and cell-matrix interactions in cells from an ocular tissue: the trabecular meshwork. J Cell Physiol. 1999;180(2):182-189. FULL TEXT | WEB OF SCIENCE | PUBMED
5. Yu AL, Fuchshofer R, Kampik A, Welge-Lüssen U. Effects of oxidative stress in trabecular meshwork cells are reduced by prostaglandin analogues. Invest Ophthalmol Vis Sci. 2008;49(11):4872-4880. FREE FULL TEXT
6. Saccà SC, Izzotti A. Oxidative stress and glaucoma: injury in the anterior segment of the eye. Prog Brain Res. 2008;173:385-407. FULL TEXT | PUBMED
7. Sacca SC, Bolognesi C, Battistella A, Bagnis A, Izzotti A. Gene-environment interactions in ocular diseases. Mutat Res. 2009;667(1-2):98-117. WEB OF SCIENCE | PUBMED
8. Indo HP, Davidson M, Yen HC; et al. Evidence of ROS generation by mitochondria in cells with impaired electron transport chain and mitochondrial DNA damage. Mitochondrion. 2007;7(1–2):106-118. FULL TEXT | WEB OF SCIENCE | PUBMED
9. Prithivirajsingh S, Story MD, Bergh SA; et al. Accumulation of the common mitochondrial DNA deletion induced by ionizing radiation. FEBS Lett. 2004;571(1–3):227-232. FULL TEXT | WEB OF SCIENCE | PUBMED
10. Abu-Amero KK, Morales J, Bosley TM. Mitochondrial abnormalities in patients with primary open-angle glaucoma. Invest Ophthalmol Vis Sci. 2006;47(6):2533-2541. FREE FULL TEXT
11. He Y, Leung KW, Zhang YH; et al. Mitochondrial complex I defect induces ROS release and degeneration in trabecular meshwork cells of POAG patients: protection by antioxidants. Invest Ophthalmol Vis Sci. 2008;49(4):1447-1458. FREE FULL TEXT
12. Cortopassi GA, Arnheim N. Detection of a specific mitochondrial DNA deletion in tissues of older human. Nucleic Acids Res. 1990;18(23):6927-6933. FREE FULL TEXT
13. Izzotti A, Saccà SC, Longobardi M, Cartiglia C. Sensitivity of ocular anterior chamber tissues to oxidative damage and its relevance to the pathogenesis of glaucoma. Invest Ophthalmol Vis Sci. 2009;50(11):5251-5258. FREE FULL TEXT
14. Pogozelski WK, Hamel CJ, Woeller CF; et al. Quantification of total mitochondrial DNA and the 4977-bp common deletion in Pearson's syndrome lymphoblasts using a fluorogenic 5'-nuclease (TaqMan) real-time polymerase chain reaction assay and plasmid external calibration standards. Mitochondrion. 2003;2(6):415-427. FULL TEXT | WEB OF SCIENCE | PUBMED
15. Markaryan A, Nelson EG, Tretiakova M, Hinojosa R. Technical report: laser microdissection of cochlear structures from celloidin embedded human temporal bone tissues and detection of the mitochondrial DNA common deletion using real time PCR. Hear Res. 2008;244(1-2):1-6. FULL TEXT | WEB OF SCIENCE | PUBMED
16. Votruba M. Molecular genetic basis of primary inherited optic neuropathies. Eye (Lond). 2004;18(11):1126-1132. FULL TEXT | WEB OF SCIENCE | PUBMED
17. Ueda J, Wentz-Hunter KK, Cheng EL, Fukuchi T, Abe H, Yue BY. Ultrastructural localization of myocilin in human trabecular meshwork cells and tissues. J Histochem Cytochem. 2000;48(10):1321-1330. FREE FULL TEXT
18. Izzotti A, Saccà SC. Glutathione S-transferase M1 and its implications in glaucoma pathogenesis: a controversial matter. Exp Eye Res. 2004;79(1):141-142, author reply 143. FULL TEXT | WEB OF SCIENCE | PUBMED
19. Izzotti A, Saccà SC, Cartiglia C, De Flora S. Oxidative deoxyribonucleic acid damage in the eyes of glaucoma patients. Am J Med. 2003;114(8):638-646. FULL TEXT | WEB OF SCIENCE | PUBMED
20. Sun T, Miao X, Zhang X, Tan W, Xiong P, Lin D. Polymorphisms of death pathway genes FAS and FASL in esophageal squamous-cell carcinoma. J Natl Cancer Inst. 2004;96(13):1030-1036. FREE FULL TEXT
21. Yildirim O, Ates NA, Tamer L; et al. May glutathione S-transferase M1 positive genotype afford protection against primary open-angle glaucoma? Graefes Arch Clin Exp Ophthalmol. 2005;243(4):327-333. FULL TEXT | WEB OF SCIENCE | PUBMED
22. Jansson M, Rada A, Tomic L, Larsson LI, Wadelius C. Analysis of the glutathione S-transferase M1 gene using pyrosequencing and multiplex PCR-no evidence of association to glaucoma. Exp Eye Res. 2003;77(2):239-243. FULL TEXT | WEB OF SCIENCE | PUBMED
23. Oka S, Ohno M, Tsuchimoto D, Sakumi K, Furuichi M, Nakabeppu Y. Two distinct pathways of cell death triggered by oxidative damage to nuclear and mitochondrial DNAs. EMBO J. 2008;27(2):421-432. FULL TEXT | WEB OF SCIENCE | PUBMED
24. Hamblet NS, Castora FJ. Mitochondrial DNA deletion analysis. a comparison of PCR quantitative methods. Biochem Biophys Res Commun. 1995;207(2):839-847. FULL TEXT | WEB OF SCIENCE | PUBMED
25. Izzotti A, De Flora S, Cartiglia C; et al. Interplay between Helicobacter pylori and host gene polymorphisms in inducing oxidative DNA damage in the gastric mucosa. Carcinogenesis. 2007;28(4):892-898. FREE FULL TEXT
26. He Y, Leung KW, Zhuo YH, Ge J. Pro370Leu mutant myocilin impairs mitochondrial functions in human trabecular meshwork cells. Mol Vis. 2009;15:815-825. WEB OF SCIENCE | PUBMED
27. Wang L, Zhuo Y, Liu B, Huang S, Hou F, Ge J. Pro370Leu mutant myocilin disturbs the endoplasm reticulum stress response and mitochondrial membrane potential in human trabecular meshwork cells. Mol Vis. 2007;13:618-625. WEB OF SCIENCE | PUBMED
28. Sohn S, Hur W, Joe MK; et al. Expression of wild-type and truncated myocilins in trabecular meshwork cells: their subcellular localizations and cytotoxicities. Invest Ophthalmol Vis Sci. 2002;43(12):3680-3685. FREE FULL TEXT
29. Kong XM, Sun XH, Yu DY, Guo WY, Yu XB. Study of retinal microvessels in a Rhesus monkey model of chronic high intraocular pressure. Vet Ophthalmol. 2008;11(5):321-326. FULL TEXT | WEB OF SCIENCE | PUBMED
30. He Y, Ge J, Tombran-Tink J. Mitochondrial defects and dysfunction in calcium regulation in glaucomatous trabecular meshwork cells. Invest Ophthalmol Vis Sci. 2008;49(11):4912-4922. FREE FULL TEXT
31. Sakai H, Shen X, Koga T; et al. Mitochondrial association of myocillin, product of a glaucoma gene, in human trabecular meshwork cells. J Cell Physiol. 2007;213(3):775-784. FULL TEXT | WEB OF SCIENCE | PUBMED
32. Li G, Luna C, Liton PB, Navarro I, Epstein DL, Gonzalez P. Sustained stress response after oxidative stress in trabecular meshwork cells. Mol Vis. 2007;13:2282-2288. WEB OF SCIENCE | PUBMED
33. Bagiyeva S, Marfany G, Gonzalez-Angulo O, Gonzalez-Duarte R. Mutational screening of CYP1B1 in Turkish PCG families and functional analyses of newly detected mutations. Mol Vis. 2007;13:1458-1468. WEB OF SCIENCE | PUBMED
34. Wentz-Hunter K, Shen X, Yue BY. Distribution of myocilin, a glaucoma gene product, in human corneal fibroblasts. Mol Vis. 2003;9:308-314. WEB OF SCIENCE | PUBMED
35. De Flora S, Scarfì S, Izzotti A; et al. Induction by 7,12-dimethylbenz(a)anthracene of molecular and biochemical alterations in transformed human mammary epithelial stem cells, and protection by N-acetylcysteine. Int J Oncol. 2006;29(3):521-529. WEB OF SCIENCE | PUBMED
36. Kofler B, Mueller E, Eder W; et al. Mitochondrial DNA haplogroup T is associated with coronary artery disease and diabetic retinopathy: a case control study. BMC Med Genet. 2009;10:35. FULL TEXT | PUBMED
37. Andrews R, Ressiniotis T, Turnbull DM; et al. The role of mitochondrial haplogroups in primary open angle glaucoma. Br J Ophthalmol. 2006;90(4):488-490. FREE FULL TEXT
38. Takahashi A, Masuda A, Sun M, Centonze VE, Herman B. Oxidative stress-induced apoptosis is associated with alterations in mitochondrial caspase activity and Bcl-2-dependent alterations in mitochondrial pH (pHm). Brain Res Bull. 2004;62(6):497-504. FULL TEXT | WEB OF SCIENCE | PUBMED
39. Bossy-Wetzel E, Barsoum MJ, Godzik A, Schwarzenbacher R, Lipton SA. Mitochondrial fission in apoptosis, neurodegeneration and aging. Curr Opin Cell Biol. 2003;15(6):706-716. FULL TEXT | WEB OF SCIENCE | PUBMED
40. Abu-Amero KK, Morales J, Bosley TM, Mohamed GH, Cabrera VM. The role of mitochondrial haplogroups in glaucoma: a study in an Arab population. Mol Vis. 2008;14:518-522. WEB OF SCIENCE | PUBMED
41. Hamard P, Valtot F, Sourdille P, Bourles-Dagonet F, Baudouin C. Confocal microscopic examination of trabecular meshwork removed during ab externo trabeculectomy. Br J Ophthalmol. 2002;86(9):1046-1052. FREE FULL TEXT
42. Abu-Amero KK, Morales J, Osman MN, Bosley TM. Nuclear and mitochondrial analysis of patients with primary angle-closure glaucoma. Invest Ophthalmol Vis Sci. 2007;48(12):5591-5596. FREE FULL TEXT


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Delicious Delicious   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter     What's this?

THIS ARTICLE HAS BEEN CITED BY OTHER ARTICLES

Mitochondria-Targeted Peptide MTP-131 Alleviates Mitochondrial Dysfunction and Oxidative Damage in Human Trabecular Meshwork Cells
Chen et al.
IOVS 2011;52:7027-7037.
ABSTRACT | FULL TEXT  

Ability of Dorzolamide Hydrochloride and Timolol Maleate to Target Mitochondria in Glaucoma Therapy
Sacca et al.
Arch Ophthalmol 2011;129:48-55.
ABSTRACT | FULL TEXT  





HOME | CURRENT ISSUE | PAST ISSUES | TOPIC COLLECTIONS | CME | PHYSICIAN JOBS | SUBMIT | SUBSCRIBE | HELP
CONDITIONS OF USE | PRIVACY POLICY | CONTACT US | SITE MAP
 
© 2010 American Medical Association. All Rights Reserved.