 |
 |


Variations in the Myocilin Gene in Patients With Open-Angle Glaucoma
Wallace L. M. Alward, MD;
Young H. Kwon, MD, PhD;
Cheryl L. Khanna, MD;
A. Tim Johnson, MD, PhD;
Sohan S. Hayreh, MD, PhD, DSc;
M. Bridget Zimmerman, PhD;
Joanna Narkiewicz, MD;
Jeaneen L. Andorf, BA;
Paula A. Moore;
John H. Fingert, MD, PhD;
Val C. Sheffield, MD, PhD;
Edwin M. Stone, MD, PhD
Arch Ophthalmol. 2002;120:1189-1197.
ABSTRACT
 |  |
Objective To determine the prevalence and associated phenotype of myocilin (MYOC) coding sequence variations and a specific promoter polymorphism
(MYOC.mt1) in patients with glaucoma and glaucoma suspects.
Methods A consecutive, unselected series of 779 patients (652 with open-angle
glaucoma and 127 glaucoma suspects) were recruited from a university medical
center and clinically characterized. The coding sequences of the MYOC gene and the MYOC.mt1 locus in the promoter region were screened for
sequence variations. We determined the prevalence of MYOC coding
sequence mutations and the MYOC.mt1 promoter polymorphism. We also compared
the clinical features of individuals with and without mutations and the MYOC.mt1
promoter polymorphism.
Results Plausible disease-causing sequence variations (DCVs) in the MYOC gene were found in 3.0% of the entire group. Such variations were
found in patients with most forms of open-angle glaucoma studied. Patients
with primary open-angle glaucoma (POAG) who harbored coding sequence DCVs
were clinically similar to patients without them. Patients who harbored the
rarer allele of the MYOC.mt1 promoter polymorphism were no different in any
measure of disease severity from those who harbored the more common allele.
Conclusions MYOC DCVs were found in approximately 3% of patients with
glaucoma and glaucoma suspects. The 2 alleles of the MYOC.mt1 promoter polymorphism
were equally distributed among patients with POAG and healthy control subjects.
Patients with POAG who harbored the rarer allele of the MYOC.mt1 promoter
polymorphism were no different from those with the more common variant in
any measure of disease severity.
Clinical Relevance Testing for the MYOC.mt1 promoter polymorphism appears to be of no value
in the evaluation of patients with glaucoma.
INTRODUCTION
GLAUCOMA IS the leading cause of permanent blindness in the world. It
is estimated that 66.8 million people have glaucoma and that 6.7 million are
bilaterally blind.1 In the United States, glaucoma
is the second-leading cause of permanent blindness and the leading cause among
African Americans.2 Primary open-angle glaucoma
(POAG) is by far the most prevalent form of glaucoma in the United States.
A significant fraction of POAG is heritable.3-5
Despite the high prevalence and heritable nature of adult-onset POAG,
identification of the causative genes has been difficult. The late onset of
the disease and its often subtle clinical findings result in relatively limited
pedigrees of living affected individuals being available for study. However,
families with juvenile-onset POAG have provided an avenue to investigate the
molecular genetics of adult-onset POAG. Autosomal dominant juvenile-onset
POAG is an uncommon form of glaucoma that shares clinical features with the
adult-onset version except for having an early age of diagnosis, very high
intraocular pressure (IOP), and autosomal dominant inheritance with high penetrance.3, 6 The study of a large multigenerational
pedigree of a family with autosomal dominant juvenile-onset POAG led to the
linkage of this disease to the long arm of chromosome 1 (1q21-1q31).7-9
In 1997, Stone et al10 identified mutations
in a gene in the disease interval that segregated with the disease phenotype.
Because the expression of this gene could be induced by applying topical corticosteroids
to cultured trabecular meshwork cells, the protein encoded by this gene was
called the trabecular meshwork-inducible glucocorticoid response protein (TIGR).11 However, the expression of this gene has also been
detected in the photoreceptors of the retina, and these investigators suggested
the name myocilin because the protein had a sequence
that was homologous to Dictyostelium discoideum myosin.12 The myocilin gene (MYOC)
encodes a 57-kd protein. The expression of the gene has been demonstrated
in the trabecular meshwork, ciliary body, retina, optic nerve, and iris of
the eye.12-14 MYOC production has also been detected in 17 of 23 other
organs.13 Despite extensive study, the normal
function of the MYOC protein is not yet known.
Stone and colleagues found MYOC mutations not
only in families with autosomal dominant juvenile-onset POAG but also in patients
with adult-onset POAG.10 Mutations were found
in 10 (4.4%) of 227 unrelated individuals with a family history of glaucoma
and 3 (2.9%) of 103 unselected patients with adult-onset POAG. Many MYOC mutations have now been found in populations around
the world.15-18
In a large study by Fingert et al,19 the DNA
from 1703 patients with POAG from 5 populations was screened for MYOC mutations. These populations included primarily white patients
from the United States, Australia, and Canada, African American patients from
the United States, and Asian patients from Japan. The prevalence of mutations
in these diverse populations was similar (2.6%-4.3%).
Although MYOC was the first open-angle glaucoma
gene to be identified in humans, it is no longer the only one. In 2002, Rezaie
et al20 discovered another gene, optineurin,
in the GLC1E interval on chromosome 10p and identified variations in this
gene in patients with POAG and normal-tension glaucoma (NTG).
Our study was designed to evaluate the prevalence of MYOC mutations in a large consecutive, unselected series of patients
with a variety of open-angle glaucomas and to determine whether there were
any phenotypic differences between patients with adult-onset POAG who harbor MYOC mutations and those who do not. During the analysis
of these data, a report appeared by Colomb et al21
suggesting that a common polymorphism located in the promoter region of the MYOC gene was associated with a poor response to glaucoma
therapy. This polymorphism is located 1000 base pairs upstream from the start
of the gene's coding sequence. Colomb and colleagues found no difference in
the prevalence of this polymorphism between patients with POAG and controls
(17.6% and 16.0%, respectively). Notwithstanding this lack of association
with the actual diagnosis of glaucoma, they hypothesized that the presence
of this polymorphism might predict the responsiveness of patients with glaucoma
to treatment. Patients with this polymorphism had a higher IOP when they enrolled
in the study than those without the polymorphism even though the 2 groups
had a similar IOP when they were first diagnosed. Colomb and colleagues claimed
that this difference indicated an unresponsiveness to glaucoma treatment.
It is important to evaluate this hypothesis critically and independently because
a commercial assay for the polymorphism has been advertised to the health
care community.
PATIENTS AND METHODS
The Human Subjects Review Committee of the University of Iowa (Iowa
City) approved this project. Written informed consent was obtained from each
study participant. During the course of 9 months, all patients at the clinics
of 4 physicians with a special interest in glaucoma (W.L.M.A., Y.H.K., A.T.J.,
and S.S.H.) were evaluated for inclusion in this study. Patients were considered
to have glaucoma if they had a cup-disc ratio greater than 0.7 with glaucomatous
visual field loss on either Goldmann or Humphrey perimetry. Patients with
smaller cup-disc ratios or optic nerve head changes alone (without visual
field loss) could be included if there was documented progression of optic
nerve head cupping. Elevated IOP was not required for the diagnosis of glaucoma.
A standard form recorded the clinical characteristics of the patients.
Patients were questioned and their records were reviewed to determine age,
sex, race, age at diagnosis, family history of glaucoma, medications used,
prior laser and incisional surgical procedures, and maximum IOP. The clinical
data that were collected included cup-disc ratio (an average of the horizontal
and vertical cup-disc ratios was used if the cup was not round), automated
static threshold perimeter (Humphrey) mean deviation and corrected pattern
SD, and manual kinetic perimeter (Goldmann) visual field loss. A simple 5-point
scale was devised for Goldmann visual field loss, which ranged from 0 for
a normal field to 4 for severe field loss and 5 for no light perception. Goldmann
perimetry may be used more commonly in our institution than in others. In
part, this is because we have 6 perimetrists with 10 to 30 years of experience
who are experts in Goldmann perimetry. Goldmann perimetry was used for individuals
who had received follow-up with this device since before the advent of automated
perimetry, who had extensive visual field loss, or who were unable to undergo
highly reliable automated testing.
Patients with open-angle glaucoma were categorized into 4 groups: those
with POAG, exfoliative glaucoma, pigmentary glaucoma, and corticosteroid-induced
glaucoma. Glaucoma suspects were also categorized into 4 groups: those with
ocular hypertension (OHT), exfoliation syndrome without glaucoma, pigment
dispersion syndrome without glaucoma, and corticosteroid-induced OHT. These
categories were selected, and the clinical features to be ascertained were
decided on prior to obtaining any clinical or molecular information. The physicians
had no knowledge of the molecular genetic status of the patients during the
collection of the data.
Patients were considered to have POAG if they had the optic nerve and
visual field features of glaucoma with no evidence of an identifiable cause
for elevated IOP. Patients with POAG were evaluated as a group and divided
into 3 subgroups: those with adult-onset POAG, juvenile-onset POAG, and NTG.
Patients with adult-onset POAG were 40 years and older and had an IOP higher
than 21 mm Hg. Those with juvenile-onset POAG were younger than 40 years and
also had an IOP higher than 21 mm Hg. Patients with NTG had an IOP of 21 mm
Hg or lower. Although the division into these 3 subgroups based on IOP and
age was arbitrary, it was done for 2 reasons. First, patients are often grouped
into these categories in clinical practice. Second, most reported MYOC mutations cause glaucoma that is characterized by a high IOP and
an early age of onset. Therefore, it seemed reasonable to separate patients
who were young and had an elevated IOP from older patients and those with
a normal IOP.
Patients with exfoliative glaucoma met the criteria for POAG but also
had typical fibrillar exfoliative material on the lens capsule. Those with
pigmentary glaucoma met the criteria for POAG with the addition of characteristic
iris transillumination defects and dense black pigment in the trabecular meshwork.
The corticosteroid-induced group had normal anterior segments but a history
of elevated IOP in response to topical corticosteroid use.
We also obtained DNA from patients with open angles who were at risk
for developing glaucoma but did not have optic nerve head damage or visual
field loss. This included patients with OHT (IOP > 21 mm Hg with no identifiable
cause of elevated IOP), exfoliation syndrome with or without OHT, pigment
dispersion syndrome with or without OHT, and corticosteroid-induced OHT.
Patients were excluded if they had any other secondary glaucoma caused
by neovascularization of the iris, inflammation, trauma, or surgery prior
to the diagnosis of glaucoma. If a known relative was already included in
the study, the patient was excluded. All eligible patients were offered participation
in this study. When patients met the entry criteria but refused venipuncture
or were unable to provide a blood specimen, clinical data were gathered to
determine whether the study group was biased. Care was taken to include all
eligible patients without biasing the sample toward or against those with
a family history. Therefore, if a participant had been tested before, either
as a member of a family or as one of the previously described patients with
POAG,10, 15, 19 we
filled out the standardized clinical data collection form but did not obtain
a second blood sample. We obtained DNA from venous blood as previously described.10
The coding sequence of the MYOC gene was screened
for variations using single-strand conformational polymorphism (SSCP) analysis
followed by bidirectional automated DNA sequencing as previously described.19 All amplimers were analyzed in standard fashion in
a single laboratory. The polymerase chain reaction amplification products
were denatured for 3 minutes at 94°C and then underwent electrophoresis
on 6% polyacrylamide, 5% glycerol gels at 25 W for approximately 3 hours.
The gels were then stained with silver nitrate.22
All SSCP gels were independently scored by a minimum of 2 experienced investigators.
Amplimers showing a band shift were reamplified and sequenced bidirectionally
using an automated sequencer (ABI 337; Applied Biosystems, Foster City, Calif)
and dye terminator chemistry. The MYOC.mt1 polymorphism was assayed using
SSCP after polymerase chain reaction amplification with the following primers:
forward, TGTGAATTTGAATGAGGAAAAA; reverse, GCAGGAGGTCTAATTTCAA. The annealing
temperature was 55°C and lasted for 1 minute. The presence of the least
common allele (a guanine residue on the sense strand 1000 base pairs upstream
from the start of transcription) was confirmed by digestion with the restriction
enzyme AlwNI at 37°C for 2 hours.
In the absence of an in vivo functional assay of a gene's product, the
pathogenicity of each observed variation is usually inferred by assessing
both the predicted effect of the variation on the structure of the gene product
and the distribution of the variant among patient and control populations.13, 15, 19 For this study, coding
sequence changes were assumed to be DCVs if they (1) would be expected to
alter the amino acid sequence of the MYOC protein, and (2) were more commonly
observed in patients with glaucoma than in controls. To meet the latter criterion,
a variant needed to be completely absent from the control population or significantly
more common (P<.05 using the Fisher exact test)
in the glaucoma population. Sequence changes were considered to be nondisease-causing
polymorphisms if they did not result in a change in the MYOC amino acid sequence
or if the change was seen equally in the control and glaucoma populations.
There were 92 control subjects without known eye abnormalities recruited
from the same population. These subjects were older than 40 years (mean ±
SD age, 61.3 ± 13.4 years; range, 43-92 years) with no history of glaucoma,
no family history of glaucoma, and an IOP of 21 mm Hg or lower. They had been
recruited for a previous study without any knowledge of their MYOC status and were found to be free of DCVs in the MYOC gene.10 Control patients were used
in this study to estimate the prevalence of the rarer allele of the MYOC.mt1
promoter polymorphism in the general population.
Patient demographics were compared between those with and without mutation
and among the polymorphism types using the Fisher exact test for the categorical
variables of sex and family history, the 2-sample t
test or 1-way analysis of variance for age at diagnosis, and the log-rank
test for age at first treatment. For the continuous and ordinal variables
that were measured for both eyes, the comparison between those with and without
mutation and among the polymorphism types was done using mixed-effects model
analysis, which accounted for the correlation between eyes from the same individual.23-24 In this study the standard mixed-effects
model, which requires a normal data distribution, could not be used because
the IOP, cup-disc ratio, and other continuous variables were not normally
distributed. As an alternative, a nonparametric rank test for mixed models
was used.25 Because these variables had a skewed
distribution, the median and interquartile range were computed instead of
the mean and SD. For the comparison involving the incidence of trabeculoplasty
in the eye, we used logistic regression analysis with the generalized estimating
equation method.26 This analysis accounts for
the correlation of dichotomous outcomes between eyes from the same person.
All statistical analyses were performed using SAS version 8.2 statistical
software (SAS Institute Inc, Cary, NC). Statistical significance was defined
as P<.05. Statistically significant P values were corrected with the Bonferroni test for multiple comparisons.
RESULTS
There were 809 patients who met the entry criteria. Of these, 23 (2.8%)
refused venipuncture, and in an additional 7 (0.9%) we were unable to obtain
a satisfactory blood sample. There were no significant differences in diagnosis,
age, sex, race, or family history between the patients who failed to enroll
in the study and those who did participate (data not shown).
Table 1 indicates the numbers
of patients with the various forms of glaucoma and the prevalence of plausible
DCVs in the MYOC gene. For the 524 patients with
POAG, 17 (3.2%) had a DCV in the MYOC gene. Disease-causing
variations were found in 13 (3.3%) of 393 individuals with adult-onset POAG.
The juvenile-onset POAG group had roughly twice the prevalence of MYOC DCVs as the adult-onset POAG group, with 3 (6.4%) of 47 patients
having a DCV. Patients with NTG had about one third the prevalence of MYOC DCVs of patients with POAG, with 1 (1.2%) of 84 patients
exhibiting a DCV. None of these differences reached statistical significance.
For every diagnosis except corticosteroid-induced glaucoma and corticosteroid-induced
OHT, at least 1 patient harbored a DCV in the MYOC
gene. Of the 4 glaucoma suspects with MYOC changes,
3 had elevated IOP. The 1 patient who had exfoliation syndrome without glaucoma
and a MYOC DCV was aged 66 years and had never had
a recorded IOP higher than 18 mm Hg.
|
|
|
|
Table 1. Study Patients Separated by Disease Category*
|
|
|
Table 2 lists the DCVs and
nondisease-causing polymorphisms found in these subjects. A total of
23 patients had DCVs; 9 different DCVs were identified, 7 of which have been
described in prior reports.15, 19
The 162Ins163 and Asp208Glu variations have not been previously reported.
As in prior studies, the Gln368Stop variant was the most common DCV seen.
This change was found in 12 patients: 9 with adult-onset POAG, 1 with juvenile-onset
POAG, 1 with OHT, and 1 with pigment dispersion syndrome without glaucoma.
Ten coding sequence polymorphisms (nondisease-causing) were identified.
All of these have previously been described.15
|
|
|
|
Table 2. Myocilin Coding Sequence Variations in Patients With a Variety
of Glaucoma Diagnoses*
|
|
|
Only the adult-onset POAG group had enough patients with a DCV to compare
the phenotypes of patients with these variations and those without. Table 3 compares the 13 patients with adult-onset
POAG and DCVs in the MYOC gene with the 380 patients
without such changes. There was no significant difference in age at diagnosis,
sex, or family history of glaucoma. Race information is not included in the
table. All patients with DCVs were white, as were the vast majority (94.8%)
of those without DCVs. This reflects the racial mix of the referral area.
There was no difference in age at first treatment, cup-disc ratio, visual
field loss, or number of medications used. Patients with DCVs had a higher
median peak IOP (P = .02). Those with DCVs were also
more likely to have undergone laser trabeculoplasty than those without MYOC sequence variations (P =
.04) but were no more likely to have required incisional surgery. Although P<.05 for the individual tests for IOP and trabeculoplasty,
considering that 12 variables were evaluated, the Bonferroni-adjusted values
for these 2 variables were P = .25 for peak IOP and P = .48 for trabeculoplasty.
|
|
|
|
Table 3. Comparison of Patients Who Had POAG With and Without Plausible
DCVs in the Myocilin Coding Sequence*
|
|
|
The 393 patients with adult-onset POAG and 92 healthy subjects were
also examined for the MYOC.mt1 promoter polymorphism (Table 4). None of the healthy subjects exhibited a DCV in the MYOC coding sequence. The rarer allele of the MYOC.mt1
polymorphism was found in 61 (15.5%) of 393 patients with adult-onset POAG
and 22 (23.9%) of 92 healthy subjects. This difference was not statistically
significant (P = .12).
|
|
|
|
Table 4. Distribution of Alleles of the MYOC.mt1 Promoter Polymorphism
in Patients With POAG and Healthy Controls*
|
|
|
The demographics and clinical features of patients who had adult-onset
POAG with and without the MYOC.mt1 promoter polymorphism are presented in Table 5. There were no statistically significant
differences in any of the measured features of disease severity between the
2 populations.
|
|
|
|
Table 5. Comparison of the Phenotypes Between Patients Who Had Adult-Onset
POAG With Various Genotypes of the MYOC.mt1 Promoter Polymorphism*
|
|
|
In the study by Colomb et al,21 most
of the data indicating an association between glaucoma severity and the MYOC.mt1
promoter polymorphism could be traced to 13 women who had glaucoma with the
rarer allele of the polymorphism; therefore, we looked at women separately. Table 6 lists the data for the 208 women
with adult-onset POAG in our study. Of these women, 32 (15.4%) harbored the
rarer allele of the MYOC.mt1 promoter polymorphism. Two women were homozygous
for this change, and 30 were heterozygous. There were no significant differences
in any of the disease severity measures between women with and without the
rarer allele (P = .44-.98).
|
|
|
|
Table 6. Comparison of the Phenotypes Between Female Patients Who Had
Adult-Onset POAG With Various Genotypes of the MYOC.mt1 Promoter Polymorphism*
|
|
|
COMMENT
MYOC was the first gene found to be associated
with open-angle glaucoma.10 It was initially
discovered by studying families with autosomal dominant juvenile-onset POAG.
Once the gene was identified, MYOC mutations were
found to cause approximately 3% of the most prevalent glaucoma, adult-onset
POAG, in a series of 103 unselected patients.
Our study was designed to determine the prevalence of MYOC DCVs in a large group of patients with open-angle glaucoma, including
a wide variety of glaucoma diagnoses. By sampling all qualifying individuals
during a 9-month period, we ascertained a broad representative cross section
of a glaucoma population. However, because this study took place in a tertiary
referral center, the relative prevalence of glaucoma types may not be representative
of the glaucoma population at large. Patients with more difficult treatment
problems such as NTG may be overrepresented, and patients with conditions
such as OHT are almost certainly underrepresented.
Of the entire group of 779 individuals, 23 (3.0%) had plausible DCVs
in 1 of the 3 coding exons of MYOC. Of the 393 patients
with adult-onset POAG, 13 (3.3%) had a DCV in the MYOC
gene. This was very close to the 2.9% that was reported by Stone et al10 in their original article describing DCVs in this
gene. There were no statistically significant differences in MYOC DCV prevalence between groups. This may be due in part to the
small numbers of patients in many disease categories.
Disease-causing variations were found in all glaucoma types with the
exceptions of corticosteroid-induced glaucoma and corticosteroid-induced OHT,
although the numbers in these 2 groups were small. The protein MYOC was identified
in the trabecular meshwork beause it was induced by the addition of corticosteroids
to trabecular meshwork cells in cell cultures.11
Although patients who respond to corticosteroids might be expected to have
a high prevalence of MYOC DCVs, a recent study by
Fingert et al27 found no significant association
between MYOC DCVs and steroid-induced OHT.
The percentage of DCVs in juvenile-onset POAG was smaller than what
might have been expected. Most families with autosomal dominant juvenile-onset
POAG had DCVs in MYOC.10
However, most patients in our study were isolated cases and were not part
of large families with autosomal dominant glaucoma.
This is the first report to show MYOC DCVs
in types of glaucoma other than adult-onset POAG,10
juvenile-onset POAG,10 OHT,28
and NTG.29 There have been no previous reports
of DCVs in exfoliative glaucoma, pigmentary glaucoma, exfoliation syndrome
without glaucoma, or pigment dispersion syndrome without glaucoma. All of
the patients with MYOC DCVs had elevated IOP except
for 1 patient with NTG and 1 patient with exfoliation syndrome without glaucoma.
Patients with the Gln368Stop variant represent an interesting subpopulation.
Of the 23 patients with DCVs found in this study, 12 (52.2%) had the Gln368Stop.
They represent 9 (69.2%) of 13 patients with adult-onset POAG and DCVs, 1
(33.3%) of 3 patients with juvenile-onset POAG and DCVs, 1 (50.0%) of 2 patients
with OHT and DCVs, and the only case of a DCV seen in pigment dispersion syndrome
without glaucoma. In a prior report from our institution, a Gln368Stop variant
was found in only 1 (0.2%) of 471 control subjects (91 healthy controls and
380 individuals with other ocular diseases whose glaucoma status was unknown).10 In one study, shared haplotype analysis demonstrated
that 27 patients with the Gln368Stop variant were all descended from a common
founder.19 None of the patients were aware
of a shared ancestry. The 9 individuals with adult-onset POAG and a Gln368Stop
variation represented 2.3% of that population. If these numbers held across
populations, the Gln368Stop variation would account for thousands of cases
of glaucoma in the United States alone.
Patients who have adult-onset POAG and harbor DCVs in the coding regions
of the MYOC gene are phenotypically similar to patients
with glaucoma who do not harbor MYOC DCVs. The mean
age of diagnosis is 60.3 years for those with DCVs compared with 61.5 years
for those without. The sex distribution is the same. Both groups had similar
numbers of patients with a family history of glaucoma. The median peak IOP
was somewhat higher for those with coding sequence DCVs (32 mm Hg OD and 30
mm Hg OS) compared with those without DCVs (26 mm Hg OU); however, the weakly
significant difference (P = .02) was lost when corrected
for multiple measures (P = .25). Most other measures
of glaucoma severity were similar between the 2 groups including cup-disc
ratio, visual field loss, number of medications used, and mean number of surgical
procedures. Patients with DCVs were somewhat more likely to have undergone
laser trabeculoplasty (P = .04), but this significance
was also lost with the Bonferroni correction for multiple comparisons (P = .48). The relatively mild nature of the glaucoma in
these patients with adult-onset POAG and DCVs is in contrast to that in patients
with autosomal dominant juvenile-onset POAG and MYOC
DCVs (such as 396Ins397, Tyr437His, and Ile477Asn), who are known to have
an aggressive form of glaucoma that is resistant to medical and laser treatment.6, 15
We found the prevalence of the rarer allele of the newly described MYOC.mt1
promoter polymorphism to be similar between patients with adult-onset POAG
and healthy control patients (15.5% and 23.9%, respectively). There were no
differences between patients who had adult-onset POAG with and without the
promoter polymorphism in any measure of disease severity examined. Colomb
and colleagues performed subgroup analysis of the effect of patient's sex
on the response to treatment. They found that most of the effect seen in their
study was a result of 13 women who had the MYOC.mt1 polymorphism.21 Because of this, they postulated that the variable
response to POAG treatment might be due to the presence of estrogen response
elements in the promoter region. We studied 208 women (32 with the rarer allele
of the MYOC.mt1 promoter polymorphism) and found no differences between those
with and without this allele in any measure of disease severity.
The discrepancy between our results and those of Colomb et al21 may be explained by differences in methods, measures
of disease severity, and analysis. Our study evaluated almost 3 times as many
patients as theirs (393 vs 142). Our patients were ascertained consecutively
and prospectively, whereas their patients were selected retrospectively. The
mean age at diagnosis of our patients with POAG was 61.4 years, which is more
typical of a POAG population than the 45.1 years reported by Colomb and colleagues.
The fact that we did not evaluate the severity of glaucoma using the same
measures as their study deserves some explanation; we used several well-established
measures of glaucoma severity and reported on every measure for which data
had been gathered at the time of patient recruitment. Significant statistical
associations were corrected for multiple comparisons.
We did not use the major disease severity measure chosen by Colomb and
colleagues (the difference between IOP at diagnosis and IOP at entry into
the study) for the following reasons: Because we are a referral center, patients
typically come to us after many years of glaucoma treatment, and the IOP at
diagnosis cannot be reliably ascertained. More important, we feel that this
measure of disease severity is so flawed that it is meaningless. In our opinion,
the difference in IOP between diagnosis and study entry would be meaningful
only if patients were treated prospectively within a rigidly defined treatment
protocol. There is no indication that the patients described by Colomb and
colleagues were treated with the same medications or with the same vigor.
It seems unreasonable to assume that patients who have a higher IOP at study
entry are resistant to medication. In glaucoma practices, patients with the
most severe disease often have the lowest treated IOP because they have the
lowest target IOP.30 One could make an equally
strong assertion for the opposite interpretation of the data of Colomb and
colleagues, that those with a higher IOP at entry into the study had milder
glaucoma because they had a higher target IOP. In reality, no conclusion can
be drawn from these differences in either direction because the treatments
the patients received between diagnosis and study entry are unknown and likely
variable.
The assertion by Colomb and colleagues that "MYOC.mt1 typing could be
a matter of public health"21 implies that clinically
important information could be obtained by screening the general population
for the MYOC.mt1 promoter polymorphism and coding sequence DCVs. Both our
study and that by Colomb and colleagues found no significant difference in
the distribution of alleles of the MYOC.mt1 polymorphism between patients
with POAG and healthy subjects; therefore, screening for this polymorphism
would not be helpful in predicting people at risk for glaucoma. Individuals
with coding sequence DCVs are at high risk for developing glaucoma.15 When the 393 patients with adult-onset POAG in our
study were screened for all DCVs in the MYOC gene,
we identified 3.3% with MYOC DCVs. Assuming that
almost 100% of those with DCVs would develop glaucoma, the best we could hope
for in a screening test would be 100% specificity and 3.3% sensitivity. This
would be a very poor screening device. The ophthalmology community has been
searching for glaucoma screening tools that are more sensitive and specific
than tonometry.31-32 A test that
is nearly 100% specific but almost totally insensitive is not a viable means
of screening for glaucoma. Although we are optimistic that molecular genetic
screening may eventually help us to identify people at risk for glaucoma within
large populations, screening the general population for MYOC variations is not a cost-effective procedure.32
The newly released OcuGene test currently costs $200 (InSite Vision,
unpublished data, 2001). This does not include any added charges from the
ordering physician. The OcuGene test assays the MYOC.mt1 promoter polymorphism
and is also supposed to test for coding sequence DCVs. However, of the dozens
of published DCVs,33 OcuGene tests for only
3. If the OcuGene test had been used to study our 393 patients with adult-onset
POAG, the tests would have cost at least $78 600. This testing would
have found no difference in the distribution of alleles of the MYOC.mt1 promoter
polymorphism between patients with glaucoma and the general population. Those
with the rarer allele of the promoter polymorphism would have exhibited no
difference in their clinical course from those without the polymorphism. Because
the test detects only 3 relatively uncommon coding sequence variations, it
would have missed all 13 patients in our study who harbored MYOC DCVs.
In summary, DCVs in the MYOC gene are associated
with a wide variety of open-angle glaucomas. About 3% of patients with adult-onset
POAG have plausible DCVs in the MYOC gene, which
is in keeping with a previous report on a smaller group of patients.10 There were no significant differences in phenotype
between patients who had adult-onset POAG with and without MYOC coding sequence DCVs. The MYOC.mt1 promoter polymorphism did not
provide any information relevant to the clinical course of the patients.
AUTHOR INFORMATION
Submitted for publication February 4, 2002; final revision received
March 28, 2002; accepted April 16, 2002.
This study was supported in part by grant EY10564 from the National
Institutes of Health, Bethesda, Md; the Carver Charitable Trust, Muscatine,
Iowa; the Grousbeck Family Foundation, Boston, Mass; the Howard Hughes Medical
Institute, Chevy Chase, Md; and unrestricted grants from Research to Prevent
Blindness, New York, NY.
We are indebted to the patients for their willing participation in this
study. We are also grateful to Rebecca Meyer and Luan Streb, BA, for their
excellent technical assistance.
Corresponding author and reprints: Edwin M. Stone, MD, PhD, Department
of Ophthalmology, University of Iowa College of Medicine, 200 Hawkins Dr,
Iowa City, IA 52242 (e-mail: edwin-stone{at}uiowa.edu).
From the Departments of Ophthalmology (Drs Alward, Kwon, Khanna, Johnson,
Hayreh, Narkiewicz, Fingert, and Stone and Mss Andorf and Moore) and Pediatrics
(Dr Sheffield), College of Medicine; the Department of Biostatistics, College
of Public Health (Dr Zimmerman); and the Howard Hughes Medical Institute (Dr
Sheffield), University of Iowa, Iowa City. The laboratories of Drs Sheffield
and Stone receive corporate support from Alcon Laboratories (Ft Worth, Tex)
and Novartis AG (Basel, Switzerland).
REFERENCES
 |  |
1. Quigley HA. Number of people with glaucoma worldwide. Br J Ophthalmol. 1996;80:389-393.
FREE FULL TEXT
2. Leske MC. The epidemiology of open-angle glaucoma: a review. Am J Epidemiol. 1983;118:166-191.
FREE FULL TEXT
3. Stokes WH. Hereditary primary glaucoma: a pedigree with five generations. Arch Ophthalmol. 1940;24:885-909.
FREE FULL TEXT
4. Kellerman L, Posner A. The value of heredity in the detection and study of glaucoma. Am J Ophthalmol. 1955;40:681-685.
5. François J. Genetics and primary open-angle glaucoma. Am J Ophthalmol. 1966;61:652-665.
WEB OF SCIENCE
| PUBMED
6. Johnson AT, Drack AV, Kwitek AE, Cannon RL, Stone EM, Alward WLM. Clinical features and linkage analysis of a family with autosomal dominant
juvenile glaucoma. Ophthalmology. 1993;100:524-529.
WEB OF SCIENCE
| PUBMED
7. Sheffield VC, Stone EM, Alward WLM, et al. Genetic linkage of familial open angle glaucoma to chromosome 1q21-q31. Nat Genet. 1993;4:47-50.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
8. Alward WLM. The genetics of open-angle glaucoma: the story of GLC1A and myocilin. Eye. 2000;14:429-436.
9. Sunden SLF, Alward WLM, Nichols BE, et al. Fine mapping of the autosomal dominant juvenile open angle glaucoma
(GLC1A) region and evaluation of candidate genes. Genome Res. 1996;6:862-869.
FREE FULL TEXT
10. Stone EM, Fingert JH, Alward WLM, et al. Identification of a gene that causes primary open angle glaucoma. Science. 1997;275:668-670.
FREE FULL TEXT
11. Polansky JR, Fauss DJ, Chen P, et al. Cellular pharmacology and molecular biology of the trabecular meshwork
inducible glucocorticoid response gene product. Ophthalmologica. 1997;211:126-139.
WEB OF SCIENCE
| PUBMED
12. Kubota R, Noda S, Wang Y, et al. A novel myosin-like protein (myocilin) expressed in the connecting
cilium of the photoreceptor: molecular cloning, tissue expression, and chromosomal
mapping. Genomics. 1997;41:360-369.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
13. Fingert JH, Ying L, Swiderski RE, et al. Characterization and comparison of the human and mouse GLC1A glaucoma
genes. Genome Res. 1998;8:377-384.
FREE FULL TEXT
14. Clark AF, Kawase K, English-Wright S, et al. Expression of the glaucoma gene myocilin (MYOC) in the human optic
nerve head. FASEB J. 2001;15:1251-1253.
FREE FULL TEXT
15. Alward WLM, Fingert JH, Coote MA, et al. Clinical features associated with mutations in the chromosome 1 open-angle
glaucoma gene (GLC1A). N Engl J Med. 1998;338:1022-1027.
FREE FULL TEXT
16. Adam MF, Belmouden A, Binisti P, et al. Recurrent mutations in a single exon encoding the evolutionary conserved
olfactomedin-homology domain of TIGR in familial open-angle glaucoma. Hum Mol Genet. 1997;6:2091-2097.
FREE FULL TEXT
17. Mansergh FC, Kenna PF, Ayuso C, Kiang AS, Humphries P, Farrar GJ. Novel mutations in the TIGR gene in early and late onset open angle
glaucoma. Hum Mutat. 1998;11:244-251.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
18. Suzuki Y, Shirato S, Taniguchi F, Ohara K, Nishimaki K, Ohta S. Mutations in the TIGR gene in familial primary open-angle glaucoma
in Japan. Am J Hum Genet. 1997;61:1202-1204.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
19. Fingert JH, Héon E, Liebmann JM, et al. Analysis of myocilin mutations in 1703 glaucoma patients from five
different populations. Hum Mol Genet. 1999;8:899-905.
FREE FULL TEXT
20. Rezaie TR, Child A, Hitchings R, et al. Adult-onset primary open-angle glaucoma caused by mutations in optineurin. Science. 2002;295:1077-1079.
FREE FULL TEXT
21. Colomb E, Nguyen TD, Bechetoille A, et al. Association of a single nucleotide polymorphism in the TIGR/MYOCILIN
gene promoter with the severity of primary open-angle glaucoma. Clin Genet. 2001;60:220-225.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
22. Bassam BJ, Caetano-Anolles G, Gresshoff PM. Fast and sensitive silver staining of DNA in polyacrylamide gels. Anal Biochem. 1991;196:80-83.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
23. Rosner B. Statistical methods in ophthalmology: an adjustment for the intraclass
correlation between eyes. Biometrics. 1982;38:105-114.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
24. Murdoch IE, Morris SS, Cousens SN. People and eyes: statistical approaches in ophthalmology. Br J Ophthalmol. 1998;82:971-973.
FREE FULL TEXT
25. Akritas MG, Brunner EA. A unified approach to rank tests for mixed models. J Stat Plann Inference. 1997;61:249-277.
FULL TEXT
26. Allison PD. Logit analysis of longitudinal and other clustered data. In: Logistic Regression Using the SAS System: Theory
and Application. Cary, NC: SAS Institute; 1999.
27. Fingert JH, Clark AF, Craig JE, et al. Evaluation of the myocilin (MYOC) glaucoma gene in monkey and human
steroid-induced ocular hypertension. Invest Ophthalmol Vis Sci. 2001;42:145-152.
FREE FULL TEXT
28. Craig JE, Baird PN, Healey DL, et al. Evidence for genetic heterogeneity within eight glaucoma families,
with the GLC1A Gln368STOP mutation being an important phenotypic modifier. Ophthalmology. 2001;108:1607-1620.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
29. Mardin CY, Velten I, Ozbey S, Rautenstrauss B, Michels-Rautenstrauss K. A GLC1A gene Gln368Stop mutation in a patient with normal-tension open-angle
glaucoma. J Glaucoma. 1999;8:154-156.
WEB OF SCIENCE
| PUBMED
30. American Academy of Ophthalmology. Primary Open-Angle Glaucoma: Preferred Practice Pattern. San Francisco, Calif: American Academy of Ophthalmology; 1996.
31. Quigley HA. Current and future approaches to glaucoma screening. J Glaucoma. 1998;7:210-220.
WEB OF SCIENCE
| PUBMED
32. Tielsch JM. Screening for glaucoma: a continuing dilemma. In: Ball SF, Franklin RM, eds. Transactions of
the New Orleans Academy of Ophthalmology. Amsterdam, the Netherlands:
Keigler; 1993:1-11.
33. Fingert JH, Stone EM, Sheffield VC, Alward WLM. Myocilin glaucoma. Surv Ophthalmol. In press.
SECTION EDITOR: EDWIN M. STONE, MD, PHD
CiteULike Connotea Del.icio.us Digg Reddit Technorati Twitter
What's this?
RELATED ARTICLE
When Does Information Become Medically Useful?: The Role of Genetic Testing in Glaucoma
Richard K. Parrish II
Arch Ophthalmol. 2002;120(9):1204-1205.
EXTRACT
| FULL TEXT
THIS ARTICLE HAS BEEN CITED BY OTHER ARTICLES
 |
Myocilin Is a Modulator of Wnt Signaling
Kwon et al.
Mol. Cell. Biol. 2009;29:2139-2154.
ABSTRACT
| FULL TEXT
Genetic Risk for Primary Open-Angle Glaucoma Determined by LMX1B Haplotypes
Park et al.
IOVS 2009;50:1522-1530.
ABSTRACT
| FULL TEXT
Transgenic Mice Expressing the Tyr437His Mutant of Human Myocilin Protein Develop Glaucoma
Zhou et al.
IOVS 2008;49:1932-1939.
ABSTRACT
| FULL TEXT
Effects of Timolol on MYOC, OPTN, and WDR36 RNA Levels
Rozsa et al.
Arch Ophthalmol 2008;126:86-93.
ABSTRACT
| FULL TEXT
Genetic Contributions to Glaucoma: Heritability of Intraocular Pressure, Retinal Nerve Fiber Layer Thickness, and Optic Disc Morphology
van Koolwijk et al.
IOVS 2007;48:3669-3676.
ABSTRACT
| FULL TEXT
Interaction between two glaucoma genes, optineurin and myocilin
Park et al.
GENES CELLS 2007;12:969-979.
ABSTRACT
| FULL TEXT
Mutated Mouse and Human Myocilins Have Similar Properties and Do Not Block General Secretory Pathway
Malyukova et al.
IOVS 2006;47:206-212.
ABSTRACT
| FULL TEXT
Linkage to 10q22 for Maximum Intraocular Pressure and 1p32 for Maximum Cup-to-Disc Ratio in an Extended Primary Open-Angle Glaucoma Pedigree
Charlesworth et al.
IOVS 2005;46:3723-3729.
ABSTRACT
| FULL TEXT
Mechanistic Insights into Glaucoma Provided by Experimental Genetics The Cogan Lecture
John
IOVS 2005;46:2650-2661.
FULL TEXT
Clinical Features and Course of Patients with Glaucoma with the E50K Mutation in the Optineurin Gene
Aung et al.
IOVS 2005;46:2816-2822.
ABSTRACT
| FULL TEXT
Molecular Analysis of the Myocilin Gene in Chinese Subjects with Chronic Primary-Angle Closure Glaucoma
Aung et al.
IOVS 2005;46:1303-1306.
ABSTRACT
| FULL TEXT
Genetically Increasing Myoc Expression Supports a Necessary Pathologic Role of Abnormal Proteins in Glaucoma
Gould et al.
Mol. Cell. Biol. 2004;24:9019-9025.
ABSTRACT
| FULL TEXT
Reversal of mutant myocilin non-secretion and cell killing: implications for glaucoma
Liu and Vollrath
Hum Mol Genet 2004;13:1193-1204.
ABSTRACT
| FULL TEXT
Genetic dissection of myocilin glaucoma
Gong et al.
Hum Mol Genet 2004;13:R91-102.
ABSTRACT
| FULL TEXT
Prevalence of optineurin sequence variants in adult primary open angle glaucoma: implications for diagnostic testing
Aung et al.
J. Med. Genet. 2003;40:e101-101.
FULL TEXT
Mutations in the Myocilin Gene in Families With Primary Open-angle Glaucoma and Juvenile Open-angle Glaucoma
Bruttini et al.
Arch Ophthalmol 2003;121:1034-1038.
ABSTRACT
| FULL TEXT
When Does Information Become Medically Useful?: The Role of Genetic Testing in Glaucoma
Parrish II
Arch Ophthalmol 2002;120:1204-1205.
FULL TEXT
|