 |
 |

Novel Mutations in the NRL Gene and Associated Clinical Findings in Patients With Dominant Retinitis Pigmentosa
Margaret M. DeAngelis, PhD;
Jonna L. Grimsby, BA;
Michael A. Sandberg, PhD;
Eliot L. Berson, MD;
Thaddeus P. Dryja, MD
Arch Ophthalmol. 2002;120:369-375.
ABSTRACT
 |  |
Objectives To search for mutations in the neural retina leucine zipper (NRL) gene in patients with dominant retinitis pigmentosa and to compare
the severity of disease in these patients with that observed previously in
patients with dominant rhodopsin mutations.
Methods Single-strand conformation analysis was used to survey 189 unrelated
patients for mutations. The available relatives of index patients with mutations
were also evaluated. In our clinical examination of patients, we measured
visual acuity, final dark-adaptation threshold equivalent visual field diameter,
and electroretinogram amplitudes among other parameters of visual function.
We compared the clinical findings with those obtained earlier from similar
evaluations of a group of 39 patients with the dominant rhodopsin mutation
Pro23His and a group of 25 patients with the dominant rhodopsin mutation Pro347Leu.
Results We identified 3 novel missense mutations in a total of 4 unrelated patients
with dominant retinitis pigmentosa: Ser50Pro, Ser50Leu (2 patients), and Pro51Thr.
Each mutation cosegregated with dominant retinitis pigmentosa. None of these
mutations were found among 91 unrelated control individuals. The visual acuities
among the 4 index patients and 3 relatives with NRL mutations
who were clinically evaluated ranged from 20/20 (in a 9-year-old patient)
to 20/200 (in a 73-year-old patient). All patients had bone-spicule pigment
deposits in their fundi. Average rod-plus-cone and cone-isolated electroretinogram
amplitudes were both decreased by 99% or more compared with normal amplitudes.
The dark-adaptation thresholds, equivalent visual field diameters, and electroretinogram
amplitudes (all corrected for age and refractive error) indicated that the
disease caused by the NRL mutations was more severe than that
caused by the dominant rhodopsin mutation Pro23His and was similar in severity
to that produced by the rhodopsin mutation Pro347Leu.
Conclusion The 3 novel NRL mutations we discovered bring the total
number of reported mutations in this gene to 6. Five of the 6 mutations affect
residues 50 or 51, suggesting that these residues are important in a structural
or functional domain of the encoded protein.
Clinical Relevance Rod and cone function is affected to a similar degree in patients with
these mutations. The disease caused by NRL mutations found in
this study appears to be more severe than that caused by the rhodopsin mutation
Pro23His and is similar in severity to that caused by the rhodopsin mutation
Pro347Leu, even after correcting for age.
INTRODUCTION
APPROXIMATELY 40% of patients with retinitis pigmentosa (RP) are from
families exhibiting a dominant mode of inheritance.1
Evidence suggests that at least 11 different genes can cause dominant RP,
only 4 of which have been identified: rhodopsin (RHO),
retinal degeneration slow (RDS), neural retinal leucine
zipper (NRL), and RP1. At
each of these loci except NRL, numerous pathogenic
mutations have been discovered. NRL is distinctive
because only 3 mutations in this gene have been reported.2-4
One mutation, Ser50Thr, was found to be associated with RP in 4 families,
all of which originated in southeast England and were likely descended from
the same ancestor.3 The mutation Pro51Leu was
found in 1 Spanish family with dominant RP, and the mutation Gly122Glu was
a new germline mutation in a simplex case of RP, also from Spain.4
Our original purpose in conducting this study was to search for additional
examples of dominant RP caused by NRL mutations.
On discovering such cases, we subsequently investigated the clinical findings
of these patients because the specifics of the phenotype produced by NRL mutations have not been previously documented. Furthermore,
we compared the clinical findings in these patients with those in patients
with the dominant rhodopsin mutations Pro23His and Pro347Leu. These 2 rhodopsin
mutations were selected for this comparison because they are the 2 most frequent
dominant rhodopsin mutations in North America and because they cause RP that
is roughly at the least severe (Pro23His) and most severe (Pro347Leu) ends
of the disease spectrum caused by dominant rhodopsin mutations.5
SUBJECTS AND METHODS
This study involved human subjects and conformed to the tenets of the
Declaration of Helsinki. Patients and controls were recruited by one of the
investigators (E.L.B.). All 189 index patients came from families with a consecutive
transmission of RP for 2 successive generations, and many showed transmission
across 3 or more generations. Patients known to have mutations in the rhodopsin, RDS, or RP1 genes were not included
in the search for mutations in the NRL gene; however,
some patients had not been screened for mutations in these other genes. To
be specific, 156 of the 189 patients had been evaluated for mutations in the
rhodopsin gene, 86 for mutations in the RDS gene,
and 173 for mutations in the RP1 gene.6-8
Normal controls had no symptoms of RP and no family history of the disease;
most normal controls did not have ocular examinations. All participants gave
their informed consent before donating 10 to 50 mL of venous blood. Leukocyte
DNA was purified using standard phenol-chloroform extraction methods.
Oligonucleotide primers based on the flanking intron sequences for each
of the 3 exons of the NRL gene were designed with
the Primer3 program (Whitehead Institute for Biomedical Research/MIT Center
for Genome Research, Cambridge, Mass). The primer pairs were as follows (sense
primer, antisense primer, both written in the 5'-3' direction):
exon 1, CACAGATGACCTCAGAGAGCTGGCCCTTTA, CAGGTGTTAAAGAGGGGGTTCTAGGTGAGC;
exon 2, ACCATCCCTCTGGCTTTCCAAACTCTTGCT, GATCTGATTGCTTTCAAGG GACCTTCTCCC;
and exon 3, GACCTGGCGCTGACCCGGTTTCTGCATTCT, GCCACCCCCACCAGCCCCCACTACACCACA.
The polymerase chain reaction was used to amplify exonic fragments from
20 ng of leukocyte DNA in a solution of 20 mM of Tris-HCl (pH, 8.4); 1.5 mM
(for exon 1), 1.0 mM (for exon 2), or 2.0 mM (for exon 3) of MgCl2;
50 mM of KCl; 0.1 mg/mL of bovine serum albumin; 0.02 mM each of dATP, dTTP,
and dGTP; 0.002 mmol of dCTP including 0.6 µCi (2.2 x 1010 µBq) of -33P; 10% dimethyl sulfoxide; and
0.25 units of Taq DNA polymerase (Perkin Elmer, Norwalk, Conn). The temperatures
used during the polymerase chain reaction were as follows: for exons 1 and
2, 94°C for 2 minutes followed by 30 cycles of 94°C for 30 seconds
and 67°C for 1 minute, with a final extension at 70°C for 5 minutes;
for exon 3, 95°C for 1 minute followed by 30 cycles of 94°C for 30
seconds and 70°C for 3 minutes, with a final extension of 70°C for
5 minutes. The DNA fragments derived from the amplification of exons 2 and
3 were digested with the restriction endonucleases HphI
and StuI, respectively. The amplified DNA fragments
were then heat-denatured and loaded on to acrylamide gels to separate the
sense and antisense strands. Anomalously migrating fragments were subsequently
analyzed using direct sequencing with an ABI PRISM 377 DNA sequencer using
the Big Dye Terminator Cycle Sequencing Ready Reaction Kit according to the
manufacturer's protocol (Applied Biosystems, Foster City, Calif).
As an additional assay for the previously published NRL mutations Ser50Thr and Pro51Leu, we amplified the DNA fragment
containing exon 2 separately without radiolabeled dCTP. After digestion with HphI, the resulting DNA fragments were separated using
electrophoresis through a 2% agarose gel with 0.4 µg/mL of ethidium
bromide. DNA samples that were not cleaved by HphI
were easily detectable by inspection.
Ocular examinations were performed according to techniques previously
described.5, 9 Specifically, dark-adapted
thresholds after 45 minutes of dark adaptation were measured with the Goldmann-Weekers
dark adaptometer using an 11° white test light projected either centrally
or, if the patient's visual field was sufficiently large, 7° below fixation.
Kinetic perimetry was performed with the V4e white test light of the Goldmann
perimeter, bringing the test light from the nonseeing to the seeing areas.
Visual field areas were determined after plotting the fields with a desktop
planimeter or by scanning images of the visual fields into a computer. Equivalent
visual field diameters were calculated as twice the square root of the visual
field area divided by ; that is, 2(area/ ) .
After 45 minutes of dark adaptation, full-field electroretinograms (ERGs)
were elicited in darkness to single, 10-µsecond flashes (0.5 Hz) of
white light (3.8 log foot-lambert) and then to 30-Hz white, 10-µsecond
flashes of the same luminance in a Ganzfeld dome. Responses were recorded
without computer averaging for amplitudes greater than 10 µV or with
computer averaging for amplitudes less than 10 µV. Amplitudes were measured
from the trough of the a-wave (or from the baseline if the a-wave was absent)
to the peak of the b-wave for responses to 0.5-Hz light flashes, and from
trough to peak for the responses to 30-Hz flashes. Nondetectable responses,
defined as amplitudes less than 1 µV for responses to 0.5-Hz light flashes
or less than 0.05 µV for responses to 30-Hz light flashes, were coded
as 1 µV or 0.05 µV, respectively, because these are the limits
of detectability. The reproducibility of sub-microvolt signals in response
to 30-Hz light flashes has been documented previously.10-11
Many patients were clinically evaluated a decade or more before the
genetic analysis. When patients had more than 1 clinical evaluation, data
from the initial visit were used for analysis. Test results from both eyes
were averaged. Mean values for ocular function (visual acuity, dark-adapted
threshold elevation, equivalent visual field diameter, log ERG amplitude with
0.5-Hz flashes, log ERG amplitude with 30-Hz flashes, and ERG implicit time
with 30-Hz flashes) were compared with data obtained previously with the same
conditions from patients who had the dominant rhodopsin mutations Pro23His
and Pro347Leu.5, 9, 12
Multiple regression analyses were performed with each measure of ocular function
as the dependent variable and with age, refractive error (spherical equivalent),
and genetic class (NRL, Pro23His, or Pro347Leu) as
the independent variables. We controlled for age and refractive error because
these factors contribute to the variation in ocular function measured in patients
with RP. Differences by genetic class (NRL vs Pro23His,
and NRL vs Pro347Leu) were assessed using linear
contrast. In addition, multiple regression analyses were also performed based
on ranks to better approximate normal distributions for the measures of ocular
function. The ocular function variables were converted to ranks and then to
the normal form based on the cumulative probability distribution function
for the normal distribution.13 Statistical
analyses were performed using the software JMP, version 3.2 (SAS Institute
Inc, Cary, NC).
RESULTS
We surveyed 189 unrelated patients with dominant RP for mutations in
the NRL gene. Three novel mutations were discovered,
all of which were missense (Figure 1):
Ser50Pro (1942 T to C), Ser50Leu (1943 C to T), and Pro51Thr (1945 C to A).
The mutations Ser50Pro and Pro51Thr were found in 1 patient each; the mutation
Ser50Leu was found in 2 unrelated index patients. None of these mutations
were found among 91 unrelated control individuals without RP. Each of the
mutations cosegregated with RP in the families of the index patients (Figure 1). No other sequence anomalies were
found in the coding sequence or the intron splice acceptor or donor sites.
|
|
|
|
Figure 1. A, Sequences of novel NRL mutations. For each of the 3 mutations, the sequence from an affected
index patient is shown above the sequence of the same region from a control
patient with the wild-type sequence. The numbers 001-083, 001-338, and 001-172
are the identification numbers of the index patients. Not shown is the sequence
of index patient 001-122, who had the same Ser50Leu mutation as patient 001-338.
The electropherogram depicting the Ser50Pro mutation in patient 001-083 was
from a sequencing run in the antisense direction; the image was flipped for
this figure to show the sense sequence, and the nucleotide colors were correspondingly
changed. Pro indicates proline; Ser, serine; Thr, threonine; and Phe, phenylalanine.
B, Schematic pedigrees of 4 families, illustrating the cosegregation of the NRL mutations with dominant retinitis pigmentosa. Filled symbols indicate
affected individuals; open symbols, unaffected individuals. Arrows point to
the index patient in each family (patient 001-083 in family 5715, 001-338
in family E481, 001-122 in family 5763, and 001-172 in family 5677). The NRL genotype of each individual whose DNA was evaluated is shown below
the corresponding symbol. The plus sign indicates the wild-type sequence of
codons 50 and 51, and A, B, and C are the mutations indicated at the bottom
of the figure.
|
|
|
To be certain that the previously reported NRL
mutations Ser50Thr and Pro51Leu were not missed because of an insensitivity
of the single-strand conformation analysis used for the mutation screen, we
specifically searched for these mutations by analyzing the amplified fragments
containing codons 50 and 51 (exon 2) after digestion with the restriction
endonuclease HphI. A recognition sequence at which
this enzyme cleaves DNA is normally present within codons 50 and 51 and is
eliminated by the mutations Ser50Thr and Pro51Leu and by other mutations of
these codons. Although this analysis failed to uncover any instances of Ser50Thr
or Pro51Leu, it did detect, as expected, the 3 novel mutations described here.
We clinically evaluated the 4 index patients and 3 of their affected
relatives with the Ser50Pro, Ser50Leu, and Pro51Thr mutations. The patients
ranged in age from 9 to 73 years. Most of these patients reported difficulty
with night vision starting in the first decade of life and limitation of peripheral
vision by the third decade (Table 1).
Posterior subcapsular cataracts were evident in 3 of the 7 patients examined,
including the 2 oldest patients (aged 34 and 73 years).
|
|
|
|
Table 1. Ocular Symptoms and Signs in Patients With NRL Mutations*
|
|
|
Fundus examinations revealed intraretinal bone-spicule pigment deposits
in all patients; however, these deposits were present in only one eye of the
youngest patient, aged 9 years. As an example of the fundus appearance of
these patients, Figure 2 shows the
fundi of patient 001-338 with the Ser50Leu mutation at age 21 years. The macula
shows attenuation of the perifoveal retinal pigment epithelium (RPE). The
arterioles are narrowed, and there are prominent intraretinal pigment deposits
in the periphery. The symmetric involvement of the two eyes is also evident.
The progression of the disease is suggested in Figure 3, which shows the fundi of 3 patients, aged 9, 42, and 73
years, all with the Pro51Thr mutation. The vascular attenuation is minimal
in the 9-year-old patient. There are patches of RPE atrophy in the 42-year-old
patient and large areas of RPE atrophy in the 73-year-old patient. In addition,
the 73-year-old patient has atrophy in the central macula.
|
|
|
|
Figure 2. Fundus photographs of patient
001-338 with the mutation Ser50Leu at age 21 years. A and B, Posterior poles
of the right and left eyes, respectively. The arterioles are attenuated, and
there is atrophy of the retinal pigment epithelium, seen most clearly around
the fovea. C and D, Views of the peripheral fundus in the right and left eyes,
respectively. Bone-spicule pigment deposits are present.
|
|
|
|
|
|
|
Figure 3. Fundus photographs of 3 patients
with the NRL mutation Pro51Thr, aged 9 years (A and B, views
of the posterior pole and nasal periphery, respectively, of the right eye),
42 years (C and D, views of the nasal periphery and posterior pole, respectively,
of the left eye), and 73 years (E and F, different views of the posterior
pole of the right eye). The extent of retinal pigment epithelial atrophy and
number of retinal pigment deposits are greater in the older individuals. The
macula of the 73-year-old patient has a mitten-shaped region of atrophy not
present in the younger patients.
|
|
|
Table 2 lists the visual
acuities, refractive errors, and additional measures of ocular function of
the patients who underwent examination. The mean visual acuity was 20/35 or
better in every patient except the oldest one, aged 73 years, who had a mean
visual acuity of 20/200. (All acuities are expressed as the mean between the
two eyes.) There was no apparent tendency toward myopia or hyperopia (mean
spherical equivalent, + 0.13 diopters). The dark-adaptation thresholds were
elevated 1.5 to 3.5 log units above normal (mean, 2.6 log units), consistent
with the symptom of night blindness in most patients. Visual fields were constricted
in all patients (mean equivalent field diameter, 57°; normal diameter, 120°).
The geometric mean 0.5-Hz (rod-plus-cone) and 30-Hz (cone) ERG amplitudes
were both reduced to 1% or less of the lower limit of normal; specifically,
the geometric mean 0.5-Hz ERG amplitude was 2.7 µV (only 0.8% of the
lower limit of normal; normal amplitude, 350 µV), and the mean 30-Hz
ERG amplitude was 0.53 µV (approximately 1% of the lower limit of normal;
normal amplitude, 50 µV). The similarly reduced amplitudes of both
the 0.5-Hz and 30-Hz ERGs indicate that rod and cone function were decreased
by an approximately equal percentage. The cone ERG implicit time was prolonged
in every patient, even in the youngest patient (aged 9 years), who had the
largest (but still subnormal) amplitude. The average cone ERG implicit time,
46 milliseconds, was 14 milliseconds longer than the outer normal limit of
32 milliseconds.
|
|
|
|
Table 2. Visual Function in Patients With NRL
Mutations*
|
|
|
We compared the mean retinal function in our set of 7 patients who had NRL mutations with that in 39 patients with the Pro23His
rhodopsin mutation and 25 patients with the Pro347Leu rhodopsin mutation who
were previously included in a study of patients with rhodopsin mutations (Table 3).5
The mean age of the patients with the NRL mutations
(30 years) was different from the mean ages of the sets of patients with the
Pro23His and Pro347Leu mutations (40 and 31 years, respectively); mean refractive
errors were also slightly different in the 3 groups (the mean spherical equivalent
was +0.13, -0.60, and -0.33 diopters in the patients with the NRL, Pro23His, and Pro347Leu mutations, respectively).
To adjust for these differences in our comparisons, the measures of ocular
function were adjusted for age and refractive error. After making these adjustments,
we found that the patients with NRL mutations had
a significantly lower mean visual acuity, higher mean dark-adapted threshold,
smaller mean equivalent visual field diameter, smaller geometric mean ERG
amplitude, and longer mean 30-Hz ERG implicit time than the patients with
the rhodopsin Pro23His mutation (Table 3). The statistical significance of the differences in ocular function
between patients with NRL mutations vs the Pro23His
mutation remained if the analysis was based on normalized ranks (data not
shown). In comparison with the patients who had the Pro347Leu mutation, those
with the NRL mutations had a significantly longer
mean 30-Hz ERG implicit time but otherwise had similar arithmetic or geometric
mean values for the other measures of ocular function (Table 3); these findings were unchanged if the analysis was based
on normalized ranks (data not shown).
|
|
|
|
Table 3. Comparisons of Visual Function in Patients With NRL Mutations vs Patients With the Rhodopsin Mutations Pro23His and
Pro347Leu*
|
|
|
COMMENT
The original designation of NRL as a cause
of dominant RP2-3 was based on
a single missense mutation, Ser50Thr, that cosegregated with dominant RP.
This mutation could have been interpreted as a rare nonpathogenic variant
that happened to be in phase with a pathogenic mutation in another closely
linked gene. This alternative explanation is unlikely because the NRL protein
with the Ser50Thr mutation functioned abnormally when studied in vitro.2 Our discovery of 3 novel mutations together with the
recent report of 2 NRL mutations (Pro51Leu and Gly122Glu)
in patients with RP from Spain4 provides additional
evidence confirming NRL as a cause of dominant RP.
Our newly discovered mutations all cosegregate with RP and were not found
among normal controls, as would be expected for dominant pathogenic mutations.
The proportion of patients with both dominant RP and NRL mutations is low. Summing our data, based on a survey of 189 unrelated
patients mostly from North America, with the published surveys of 200 and
130 patients from England and Spain, respectively,3-4
a total of 8 of 519 unrelated patients with dominant RP have the disease because
of NRL mutations. After correcting for the fact that
patients with mutations in the rhodopsin and RDS
genes were generally excluded from these surveys (together these genes account
for about 18%-28% of dominant RP cases),4, 6-7
we estimate the proportion of dominant RP caused by mutations in the NRL gene to be approximately 1%.
The protein NRL is a member of the v-maf family of transcription factors.14 The protein is 237 amino acid residues in size and
is encoded by a gene with 3 exons.15 The protein
can form a complex with another transcription factor, CRX. Data reported by
Mitton et al16 suggest that NRL forms a homodimer
mediated by its leucine zipper motif and that this homodimer may form the
structure recognized by CRX. NRL is expressed in the brain and retina, whereas
CRX is expressed in the pineal body and retina.17-20
Both of these DNA-binding proteins recognize sequences in the promoters of
photoreceptor-specific genes such as those encoding rhodopsin and interphotoreceptor
retinoid binding protein).19, 21-22
In vitro, the NRL-CRX complex can activate the rhodopsin promoter approximately
10 times as well as CRX alone and 80 times as well as NRL alone.19
In vivo, the onset of NRL expression during retinal development is later than
that of CRX, indicating that the NRL-CRX complex is probably not necessary
for certain stages of photoreceptor development and differentiation.23
It is notable that the 3 novel mutations and the 3 previously reported
mutations are all missense mutations and that 5 of the 6 mutations affect
amino acid residues 50 or 51. This observation supports the notion that residues
50 and 51 are part of an important functional or structural domain. One of
the 4 mutants, Ser50Thr, when expressed in vitro together with CRX, has an
increased ability to activate the rhodopsin promoter compared with wild-type
NRL, also expressed together with CRX.2 It
will be interesting to see if the other mutants share this property or if
some other functional abnormality shared by the 4 mutants could explain their
toxic effects on photoreceptor cells.
Fundus abnormalities, elevated dark-adaptation thresholds, constricted
visual fields, and reduced and delayed ERGs were all present in patients with NRL mutations, as is typical of dominant RP. We observed
that rod and cone function, as monitored by the full-field ERG, were comparably
reduced in patients with NRL mutations. Although
we observed an apparent progression of retinal degeneration by comparing patients
of different ages with the same NRL mutation (Figure 3), an accurate description of the
course of disease associated with NRL mutations would
require longitudinal follow-up of large patient cohorts.
Even after correcting for age, patients with NRL
mutations exhibited on average more severe disease than patients with the
rhodopsin mutation Pro23His, based on every measure of retinal function we
examined. As examples, the patients with the NRL
mutations had about a 2-fold smaller mean visual field diameter and about
a 30-fold lower geometric mean cone ERG amplitude. In contrast, retinal function
of the patients with NRL mutations was, for the most
part, similar to that of patients with the rhodopsin mutation Pro347Leu, which
causes RP at the severe end of the spectrum of disease produced by dominant
rhodopsin mutations.5 The comparisons between
the RP caused by NRL vs rhodopsin mutations are tentative,
however, because they are based on a small group of patients with the NRL mutations.
AUTHOR INFORMATION
Submitted for publication June 13; final revision received October 25,
2001; accepted November 16, 2001.
This work was supported by grants R01 EY08683, R01 EY00169, and R01
EY11655 from the National Institutes of Health, Bethesda, Md; a National Research
Service Award (EY07076) to Dr DeAngelis from the National Institutes of Health;
the Foundation Fighting Blindness, Owings Mills, Md; and a grant from the
Massachusetts Lions Eye Research Foundation Inc, Salisbury, Mass.
We thank T. McGee and P. Rodriguez for their contributions to this study.
Corresponding author and reprints: Thaddeus P. Dryja, MD, Massachusetts
Eye and Ear Infirmary, 243 Charles St, Boston, MA 02114 (e-mail: dryja{at}helix.mgh.harvard.edu).
From the Ocular Molecular Genetics Institute and the Berman-Gund Laboratory
for the Study of Retinal Degenerations, Harvard Medical School, Massachusetts
Eye and Ear Infirmary, Boston.
REFERENCES
 |  |
1. Bunker CH, Berson EL, Bromley WC, Hayes RP, Roderick TH. Prevalence of retinitis pigmentosa in Maine. Am J Ophthalmol. 1984;97:357-365.
ISI
| PUBMED
2. Bessant DAR, Payne AM, Mitton KP, et al. A mutation in NRL is associated with autosomal
dominant retinitis pigmentosa. Nat Genet. 1999;21:355-356.
FULL TEXT
|
ISI
| PUBMED
3. Bessant DA, Payne AM, Plant C, Bird AC, Swaroop A, Bhattacharya SS. NRL S50T mutation and the importance of "founder
effects" in inherited retinal dystrophies. Eur J Hum Genet. 2000;8:783-787.
FULL TEXT
|
ISI
| PUBMED
4. Martinez-Gimeno M, Maseras M, Baiget M, Beneito M, Antinolo G, Ayuso C, Carballo M, et al. Mutations P51U and G122E in retinal transcription factor NRL associated
with autosomal dominant and sporadic retinitis pigmentosa. Hum Mutat. 2001;17:520.
FULL TEXT
5. Sandberg MA, Weigel-DiFranco C, Dryja TP, Berson EL. Clinical expression correlates with location of rhodopsin mutation
in dominant retinitis pigmentosa. Invest Ophthalmol Vis Sci. 1995;36:1934-1942.
FREE FULL TEXT
6. Dryja TP, McEvoy JA, McGee TL, Berson EL. Novel rhodopsin mutations Gly114Val and Gln184Pro in dominant retinitis
pigmentosa. Invest Ophthalmol Vis Sci. 2000;41:3124-3127.
FREE FULL TEXT
7. Dryja TP, Hahn LB, Kajiwara K, Berson EL. Dominant and digenic mutations in the peripherin/RDS and ROM1 genes in retinitis pigmentosa. Invest Ophthalmol Vis Sci. 1997;38:1972-1982.
FREE FULL TEXT
8. Pierce EA, Quinn T, Meehan T, McGee TL, Berson EL, Dryja TP. Mutations in a gene encoding a new oxygen-regulated photoreceptor protein
cause dominant retinitis pigmentosa. Nat Genet. 1999;22:248-254.
FULL TEXT
|
ISI
| PUBMED
9. Berson EL, Rosner B, Sandberg MA, Dryja TP. Ocular findings in patients with autosomal dominant retinitis pigmentosa
and a rhodopsin gene defect (Pro23His). Arch Ophthalmol. 1991;109:92-101.
FREE FULL TEXT
10. Andréasson SOL, Sandberg MA, Berson EL. Narrow-band filtering for monitoring low-amplitude cone electroretinograms
in retinitis pigmentosa. Am J Ophthalmol. 1988;105:500-503.
ISI
| PUBMED
11. Birch DG, Sandberg MA. Submicrovolt full-field cone electroretinograms: artifacts and reproducibility. Doc Ophthalmol. 1996-97;92:269-280.
12. Berson EL, Rosner B, Sandberg MA, Weigel-DiFranco C, Dryja TP. Ocular findings in patients with autosomal dominant retinitis pigmentosa
and rhodopsin, proline-347-leucine. Am J Ophthalmol. 1991;111:614-623.
ISI
| PUBMED
13. Ferguson GA. Statistical Analysis in Psychology and Education. New York, NY: McGraw-Hill; 1966.
14. Swaroop A, Xu JZ, Pawar H, Jackson A, Skolnick C, Agarwal N. A conserved retina-specific gene encodes a basic motif/leucine zipper
domain. Proc Natl Acad Sci U S A. 1992;89:266-270.
FREE FULL TEXT
15. Farjo Q, Jackson A, Pieke-Dahl S, et al. Human bZIP transcription factor gene NRL:
structure, genomic sequence, and fine linkage mapping at 14q11.2 and negative
mutation analysis in patients with retinal degeneration. Genomics. 1997;45:395-401.
FULL TEXT
|
ISI
| PUBMED
16. Mitton KP, Swain PK, Chen S, Xu S, Zack DJ, Swaroop A. The leucine zipper of NRL interacts with the
CRX homeodomain. J Biol Chem. 2000;275:29794-29799.
FREE FULL TEXT
17. Liu Q, Ji X, Breitman ML, Hitchcock PF, Swaroop A. Expression of the bZIP transcription factor gene Nrl in the developing nervous system. Oncogene. 1996;12:207-211.
ISI
| PUBMED
18. Furukawa T, Morrow EM, Cepko CL. Crx, a novel otx-like homeobox gene, shows
photoreceptor-specific expression and regulates photoreceptor differentiation. Cell. 1997;91:531-541.
FULL TEXT
|
ISI
| PUBMED
19. Chen SM, Wang QL, Nie ZQ, et al. Crx, a novel otx-like paired-homeodomain protein, binds to and transactivates
photoreceptor cell-specific genes. Neuron. 1997;19:1017-1030.
FULL TEXT
|
ISI
| PUBMED
20. Swain PK, Hicks D, Mears AJ, et al. Multiple phosphorylated isoforms of NRL are
expressed in rod photoreceptors. J Biol Chem. 2001;276:36824-36830.
FREE FULL TEXT
21. Chen SM, Zack DJ. Ret4, a positive acting rhodopsin regulatory element identified using
a bovine retina in vitro transcription system. J Biol Chem. 1996;271:28549-28557.
FREE FULL TEXT
22. Kumar R, Chen SM, Scheurer D, et al. The bZIP transcription factor Nrl stimulates rhodopsin promoter activity
in primary retinal cell cultures. J Biol Chem. 1996;271:29612-29618.
FREE FULL TEXT
23. Bibb LC, Holt JKL, Tarttelin EE, et al. Temporal and spatial expression patterns of the CRX transcription factor
and its downstream targets: critical differences during human and mouse eye
development. Hum Mol Genet. 2001;10:1571-1579.
FREE FULL TEXT
SECTION EDITOR: EDWIN M. STONE, MD, PHD
CiteULike Connotea Del.icio.us Digg Reddit Technorati
What's this?
THIS ARTICLE HAS BEEN CITED BY OTHER ARTICLES
 |
A heterozygous c-Maf transactivation domain mutation causes congenital cataract and enhances target gene activation
Perveen et al.
Hum Mol Genet 2007;16:1030-1038.
ABSTRACT
| FULL TEXT
Prevalence of disease-causing mutations in families with autosomal dominant retinitis pigmentosa: a screen of known genes in 200 families.
Sullivan et al.
IOVS 2006;47:3052-3064.
ABSTRACT
| FULL TEXT
Screen of the IMPDH1 Gene among Patients with Dominant Retinitis Pigmentosa and Clinical Features Associated with the Most Common Mutation, Asp226Asn
Wada et al.
IOVS 2005;46:1735-1741.
ABSTRACT
| FULL TEXT
Recessive NRL mutations in patients with clumped pigmentary retinal degeneration and relative preservation of blue cone function
Nishiguchi et al.
Proc. Natl. Acad. Sci. USA 2004;101:17819-17824.
ABSTRACT
| FULL TEXT
The Minimal Transactivation Domain of the Basic Motif-Leucine Zipper Transcription Factor NRL Interacts with TATA-binding Protein
Friedman et al.
J. Biol. Chem. 2004;279:47233-47241.
ABSTRACT
| FULL TEXT
Altered Expression of Genes of the Bmp/Smad and Wnt/Calcium Signaling Pathways in the Cone-only Nrl-/- Mouse Retina, Revealed by Gene Profiling Using Custom cDNA Microarrays
Yu et al.
J. Biol. Chem. 2004;279:42211-42220.
ABSTRACT
| FULL TEXT
Expression profiling of the developing and mature Nrl-/- mouse retina: identification of retinal disease candidates and transcriptional regulatory targets of Nrl
Yoshida et al.
Hum Mol Genet 2004;13:1487-1503.
ABSTRACT
| FULL TEXT
Shared Mutations in NR2E3 in Enhanced S-cone Syndrome, Goldmann-Favre Syndrome, and Many Cases of Clumped Pigmentary Retinal Degeneration
Sharon et al.
Arch Ophthalmol 2003;121:1316-1323.
ABSTRACT
| FULL TEXT
Interaction of retinal bZIP transcription factor NRL with Flt3-interacting zinc-finger protein Fiz1: possible role of Fiz1 as a transcriptional repressor
Mitton et al.
Hum Mol Genet 2003;12:365-373.
ABSTRACT
| FULL TEXT
|