 |
 |

Statin Inhibits Leukocyte-Endothelial Interaction and Prevents Neuronal Death Induced by Ischemia-Reperfusion Injury in the Rat Retina
Megumi Honjo, MD, PhD;
Hidenobu Tanihara, MD, PhD;
Kazuaki Nishijima, MD;
Junichi Kiryu, MD, PhD;
Yoshihito Honda, MD, PhD;
Beatrice Y. J. T. Yue, PhD;
Tatsuya Sawamura, MD, PhD
Arch Ophthalmol. 2002;120:1707-1713.
ABSTRACT
 |  |
Background Retinal ishchemiainduced neuronal death is believed to be a direct causal process in the development of many ocular diseases. The 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitor, statin, is known to improve endothelial function in proinflammatory conditions.
Objective To investigate the effects of statin on leukocyte accumulation during ischemia-reperfusion injury and on subsequent retinal damage.
Methods Transient retinal ischemia was induced in Long-Evans rats for 60 minutes using temporal ligation of the optic nerve. Leukocyte-endothelial interactions in the postischemic retina were evaluated in vivo with a scanning laser ophthalmoscope. Statin was administered 5 minutes before the induction of retinal ischemia. P-selectin and intercellular adhesion molecule-1 (ICAM-1) gene expression in the postischemic retina were studied with the semiquantitative polymerase chain reaction. Histologic studies were carried out to evaluate retinal damage.
Results The preadministration of statin attenuated the rolling and accumulation of leukocytes, decreased P-selectin and ICAM-1 expression, and reduced the number of apoptotic cells in the retina. Furthermore, histologic evaluation 168 hours after reperfusion showed that statin significantly diminished the resultant retinal tissue damage. The neuroprotective effect of statin was abolished when it was administered along with a nitric oxide synthase inhibitor, nitroglycerine-nitro-L-arginine methyl ester.
Conclusion Statin may exert neuroprotective effects by inhibiting leukocyte-endothelial interaction through the release of nitric oxide from the endothelium.
Clinical Relevance As a result of its efficacy in preventing retinal neuronal death, statin may be developed into a novel therapeutic modality for many ocular ischemic diseases.
INTRODUCTION
THE ISCHEMIA-REPERFUSION model has been established and commonly used in the retinal microvasculature of rats to induce neuronal death in the retina and thereby treat many ocular diseases, including diabetic retinopathy and glaucoma.1-2 This model has demonstrated that leukocytes play a critical role in ischemia-reperfusion injury. Prevention of the recruitment of leukocytes to retinal tissue reduces ischemia-reperfusion injury by blocking the leukocyte adhesion molecules P-selectin and intercellular adhesion molecule-1 (ICAM-1).3
The 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitors, collectively referred to as statins, have been broadly used as an important therapeutic modality for hypercholesterolemia. These inhibitors exert their biological effects by blocking the conversion of HMG-CoA to mevalonate. The subsequent lipid-lowering effect is correlated with decreased coronary and cerebrovascular events, improving survival rates in patients with coronary artery disease.4-7 Recent studies have also suggested that in addition to inhibiting cholesterol synthesis, statins have so-called pleiotropic effects and may contribute to the diminution of cerebrovascular and cardiovascular risks, even in patients with normocholesterolemia.8-9 Several investigators have provided evidence that statins administered to animals with normocholesterolemia protect the vascular endothelium from damage caused by inflammatory processes.10-12 Statins up-regulate and activate endothelial (type 3) nitric oxide synthase (eNOS)13 and decrease the expression of cell adhesion molecules in the endothelial cells.14
In this context, amelioration of endothelial function through the pleiotropic actions of statins could also be beneficial in glaucoma for protecting retinal neurons from death. In our study, we examined this possibility using the ischemia-reperfusion model in the rat retinal microvasculature.
METHODS
ANIMAL AND ISCHEMIA MODEL
Male pigmented Long-Evans rats (200-250 g) were used in this study. All experiments were performed in accordance with the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Vision Research.
Transient retinal ischemia was induced in the right eye of each rat according to the method of Stefansson et al,15 with slight modifications.3, 16 Rats were anesthetized with a mixture (1:1) of xylazine hydrochloride (4 mg/kg) and ketamine hydrochloride (10 mg/kg). The pupils were dilated with 0.5% tropicamide and 2.5% phenylephrine hydrochloride. After lateral conjunctival peritomy and disinsertion of the lateral rectus muscle, the optic nerve head of the right eye was exposed using blunt dissection. A 6-0 nylon suture was passed around the optic nerve and tightened until the blood flow ceased in all of the retinal vessels. After 60 minutes of ischemia, complete nonperfusion was confirmed through an operating microscope, and the suture was removed. Reperfusion of the vessels was also observed through the operating microscope.
CHEMICALS AND DRUG ADMINISTRATION
The effects of 2 statins were evaluated at each drug's daily clinical dose for hyperlipidemia. Pravastatin sodium and cerivastatin sodium were generously provided by Sankyo Co, Ltd (Tokyo, Japan), and Bayer Co, Ltd (Leverkusen, Germany), respectively. Nitroglycerine-nitro-L-arginine methyl ester (L-NAME) was obtained from Sigma Chemical Co (St Louis, Mo), and acridine orange was obtained from Wako Pure Chemicals (Osaka, Japan). Pravastatin (0.5 mg/kg), cerivastatin (0.1 mg/kg), or L-NAME (5 mg/kg) was given intravenously 5 minutes before the induction of ischemia. For controls, the same volume of saline was administered. To examine the short-term effects of statin, the same amount of the drug was also given intravenously 15 minutes before acridine orange digital fluorography.
ACRIDINE ORANGE DIGITAL FLUOROGRAPHY
Acridine orange digital fluorography has previously been described in detail.17-18 The evaluation of leukocyte dynamics was performed 12 hours after reperfusion in both statin- and vehicle (phosphate-buffered saline [PBS])treated groups because previous studies had confirmed that the number of rolling leukocytes reached its peak 12 hours after ischemia-reperfusion induction.3 For acridine orange digital fluorography, rats were anesthetized with the same agent used before ischemia induction, and the pupils were dilated. A contact lens was placed on the cornea to maintain transparency throughout the experiments. Each rat had a catheter inserted into the tail vein and was placed on a movable platform. Body temperature was maintained between 37°C and 39°C throughout the experiment, and arterial blood pressure was monitored with a blood pressure analyzer (IITC Inc, Woodland Hills, Calif). Acridine orange (0.1% solution in saline) was injected continuously through the catheter for 1 minute at a rate of 1 mL/min.
Immediately after the acridine orange solution was infused intravenously, leukocytes were stained selectively among the circulating blood cells. The leukocytes that had accumulated in the retina remained fluorescent for approximately 2 hours. Thirty minutes after the injection, the accumulated leukocytes were identified as distinct fluorescent dots with the highest contrast. The images were recorded on a standard videotape at the rate of 30 frames per second and analyzed with an image analysis system, which consisted of a computer equipped with a video digitizer (Radius, San Jose, Calif), as described elsewhere in detail.17-18 Using this system, we determined both the flux of leukocytes rolling along the lining of major vessels and the leukocyte rolling velocity.
The number of rolling leukocytes in each major retinal vein was calculated as the number of rolling leukocytes along each vein for 1 minute at a distance of 200 µm from the optic disc center (ie, leukocyte flux). The average of the individual numbers was used as the number of rolling leukocytes for each rat. The velocity of rolling leukocytes was calculated as the time required for a leukocyte to travel a given distance (30 µm) along the vessel.
We also evaluated the number of leukocytes that had accumulated in the retinal microcirculation 30 minutes after acridine orange injection. The number of fluorescent dots in the retina within 8 to 10 areas of 100 square pixels at a distance of 1 disc diameter from the edge of the optic disc was counted and averaged. This was used as the number of accumulated leukocytes in the retinal microcirculation for each rat.
After the previously described laser ophthalmoscopic images were obtained, the rat was euthanized with an overdose of anesthesia. The eye was enucleated to determine a calibration factor to convert values measured on the computer monitor (in pixels) into absolute values (in micrometers).
SEMIQUANTIFICATION OF GENE EXPRESSION OF P-SELECTIN AND ICAM-1
Five eyes from 5 rats each in the statin-treated, vehicle-treated, and nonsurgically treated control groups were obtained to evaluate the gene expression of adhesion molecules P-selectin and ICAM-1. Twelve hours after reperfusion, the eyes were enucleated, and the retina was collected from the posterior segment. The total RNA was isolated from the retina according to the acid guanidinium thiocyanate-phenol-chloroform extraction method.19 The extracted RNA was quantified, and 5 µg of the RNA was reverse-transcribed into complementary DNA (cDNA) with a first strand cDNA synthesis kit (Life Technologies Inc, Gaithersburg, Md). The polymerase chain reaction (PCR) was performed with the following conditions: denaturation at 94°C for 30 seconds, annealing at 55°C for 1 minute, and polymerization at 72°C for 1 minute. The reaction was carried out for 30 cycles for P-selectin and 25 cycles for glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The primers for P-selectin, ICAM-1, and GAPDH were as follows: CAAGAGGAACAACCAGGACT (sense) and AATGGCTTCACAGGTTGGCA (antisense); AGACACAAGCAAGAGAAGAA (sense) and GAGAAGCCCAAACCCGTATG (antisense); and TGGCACAGTCAAGGCTGAGA (sense), AGCTGAGAGGGAAATCGTGC (sense), and CTTCTGAGTGGCAGTGATGG (antisense), respectively. Nucleotide sequencing and restriction pattern analysis confirmed that PCR products were derived from the target cDNA sequences. The PCR product of ICAM-1 was semiquantitatively analyzed with NIH Image version 1.61 statistical software (National Institutes of Health, Bethesda, Md).
TUNEL STAINING
Twenty-four hours after reperfusion, the eyes were enucleated, and we performed TUNEL (terminal deoxynucleotidyl transferasemediated deoxyuridine triphosphate nick-end labeling) staining. This time point was selected based on the previous finding that peak TUNEL staining was observed 24 hours after reperfusion.20 Four eyes from 4 rats each in the statin-treated, vehicle-treated, and nonsurgically treated control groups were obtained to evaluate the staining. Rats were perfusion-fixed with 4% paraformaldehyde/PBS before enucleation. The enucleated eyes were further fixed for 2 hours at 4°C in 4% paraformaldehyde/PBS, washed for 5 minutes in PBS, gently shaken overnight at 4°C in 15% sucrose/0.1M PBS, embedded in a tissue processor (Tissue-Tek; Miles Inc, Elkhart, Ind), and frozen in liquid nitrogen. A cryostat was used to cut 6-mm sections, which were collected onto silanized slides (DAKO Japan, Kyoto) and air dried. After being rinsed in PBS and undergoing a reaction with proteinase K, the sections were incubated at 37°C with terminal deoxyuridine triphosphate (dUTP) transferase and biotinylated dUTP in a terminal deoxynucleotidyl transferase buffer (30M Tris; pH, 7.2; 140mM sodium cacodylate; 1M cobalt chloride) for 60 minutes in a moist chamber. The sections were then processed for avidin-peroxidase activity, counterstained with propidium iodide (Sigma, St Louis, Mo), and examined using a scanning laser confocal microscope (Bio-Rad Laboratories, Hercules, Calif).
HISTOLOGIC ANALYSIS
Six eyes from 6 rats each in the statin-treated, L-NAME and statin-treated, L-NAMEtreated, vehicle-treated, and nonsurgically treated control groups were obtained to evaluate the severity of retinal damage. After 168 hours of reperfusion, the rats were euthanized with an overdose of anesthesia. The eyes were immediately enucleated, and a small incision was made at the corneoscleral limbus. These eyes were fixed in 2% formaldehyde and 2.5% glutaraldehyde in phosphate buffer, followed by 4% formaldehyde. They were then dehydrated, embedded in paraffin, sliced with a microtome into 2-mm-thick sections, and stained with hematoxylin-eosin. Each section was cut along the horizontal meridian of the eye through the optic nerve head perpendicular to the retinal surface.
To quantify the degree of retinal damage, changes in thickness and linear cell densities (number of nuclei in a 50-mm-wide band) within the various retinal layers were measured using the method described by Hughes,21 with slight modification.22 The thickness of the inner plexiform layer (IPL), inner nuclear layer (INL), outer nuclear layer (ONL), and overall retina from inner to outer limiting membrane (ILM-OLM) were determined. The number of cell nuclei in the ganglion cell layer (GCL) was also counted. These measurements were made at a distance of 1.5 mm from the center of the optic nerve head. The value was averaged from 5 measurements in the temporal and nasal hemispheres of 4 different sections.
STATISTICAL ANALYSIS
All values are presented as mean ± SEM. The data were analyzed by 1-way analysis of variance using a post hoc test with the Fisher protected least significant difference procedure. Differences were considered statistically significant when P<.05.
RESULTS
EFFECTS OF STATIN ON LEUKOCYTE-ENDOTHELIAL INTERACTION
In all of the ischemic eyes examined, leukocytes were observed to roll slowly along retinal veins but not along any major retinal arteries (Figure 1A, left panel). No rolling of leukocytes along the major retinal veins was observed in nonischemic control eyes (data not shown). The results for the leukocyte rolling are shown in Figure 1B. The number of rolling leukocytes in the pravastatin- and cerivastatin-treated rats was significantly reduced (by 10.8%; P<.001) (Figure 1A, right panel) compared with vehicle-treated rats (Figure 1B, left). The velocity of leukocyte rolling was significantly faster in statin-treated rats (P<.001) (Figure 1B, right).
|
|
|
|
Figure 1. Effect of statin on leukocyte dynamics. A, Fluorescent fundus images 12 hours after reperfusion. Arrowheads point to rolling leukocytes along major veins. B, The number (left) and velocity (right) of rolling leukocytes were recorded along the major retinal veins after reperfusion. Values are presented as mean ± SEM. Asterisks indicate P<.001 compared with control values. For each group, n = 6.
|
|
|
The number of accumulated leukocytes was also significantly lower in pravastatin- and cerivastatin-treated rats than in vehicle-treated ones (Figure 2A). As presented in Figure 2B, the mean ± SEM number of leukocytes accumulated in the retinal microcirculation in the statin-treated group 12 hours after reperfusion was 157.0 ± 20.6 cells/mm2, significantly fewer (by 30.6%; P<.001) than in vehicle-treated rats.
|
|
|
|
Figure 2. Leukocyte accumulation in the retina. Leukocytes accumulated in the retina were observed as fluorescent dots 30 minutes after acridine orange injection. Many leukocytes were found in control rats (A, left panel). A significant reduction in leukocyte accumulation was seen in cerivastatin-treated rats 12 hours after reperfusion (A, right panel). B, The number of accumulated leukocytes was calculated. Asterisks indicate P<.001 compared with vehicle-treated rats.
|
|
|
In parallel experiments, the short-term effect of cerivastatin (0.1 mg/kg) on the rolling and accumulation of leukocytes was examined 12 hours after reperfusion. Statin administered 15 minutes prior to the acridine orange injection did not significantly affect either rolling or accumulation (data not shown). Thus, this inhibitor might not have a direct short-term effect on the leukocyte-endothelial interaction.
GENE EXPRESSION OF P-SELECTIN AND ICAM-1 IN THE RETINA
To investigate the mechanism of statin-mediated inhibition of the leukocyte-endothelial interaction, we determined the expression levels of adhesion molecules in cerivastatin-treated and untreated rat retinas. As shown in Figure 3, P-selectin and ICAM-1 gene expression were significantly decreased by cerivastatin treatment 12 hours after reperfusion, suggesting that statin suppressed the activation of endothelial cells after ischemia-reperfusion induction (Figure 3B).
|
|
|
|
Figure 3. The P-selectin and intracellular adhesion molecule-1 (ICAM-1) gene expression are measured in the retina after reperfusion. A, Representative result of P-selectin, ICAM-1, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene expression in the rat retina 12 hours after ischemia-reperfusion injury. B, Semiquantitative analyses of the gene expression of P-selectin and ICAM-1. Data are shown as a ratio of the mean values of control rats. Values are presented as mean ± SEM. Single asterisk indicates P<.05 compared with control values; double asterisk indicates P<.005 compared with control values. For each group, n = 5.
|
|
|
EFFECT OF STATIN ON APOPTOSIS INDUCED BY RETINAL ISCHEMIA INJURY
Typical changes caused by TUNEL staining after ischemia-reperfusion injury with or without statin treatment are shown in Figure 4. In nonsurgically treated rat retinas, TUNEL staining showed no cell abnormalities in any of the layers. In vehicle-treated control rat retinas, TUNEL staining revealed many abnormalities in the INL and ONL. There were fewer abnormal cells in the GCL and ONL compared with the INL, in agreement with previous findings by Katai and Yoshimura23 that the peak of TUNEL reactivity was observed 24 hours after ischemic insult in the INL and 48 hours after this occurrence in the ONL. The number of abnormal cells in the INL of the retina was significantly decreased by intravitreal treatment with statin (Figure 4). The number of abnormal cells 24 hours after reperfusion in statin-treated retinal sections 17.1 ± 5.8 cells/mm; P<.001 using analysis of variance) was much lower than in the vehicle-treated retinas 85.2 ± 9.6 cells/mm).
|
|
|
|
Figure 4. Representative confocal microscopic image of TUNEL (terminal deoxynucleotidyl transferasemediated deoxyuridine triphosphate nick-end labeling) staining showing abnormal cells in the rat retina 24 hours after ischemia-reperfusion injury. Left panel: control eye without ischemia-reperfusion injury; middle panel: ischemia-reperfusion injury with no treatment; right panel: ischemia-reperfusion injury with cerivastatin treatment (indicated by plus and minus signs). These are digitally overlaid images of staining with propidium iodide (red) and TUNEL (green). Arrows indicate cell abnormalities as determined with both propidium iodide and TUNEL. Bar represents 50 mm.
|
|
|
HISTOLOGIC ANALYSIS OF RETINAL DAMAGE
To further investigate the protective effect of statin against retinal ischemia-reperfusion injury, we performed a quantitative histologic analysis (Figure 5A). Ischemia-reperfusion induction of the retina caused severe destruction of the inner retinal elements, resulting in decreased thickness and damage of the retinal cells. The thickness of the IPL, INL, and ILM-OLM in vehicle-treated rats (57.3%, 70.1%, and 75.0%, respectively, of that in nonsurgically treated rats) was significantly reduced (P<.001, P<.004, and P<.001, respectively). In addition, the cell density of the GCL in vehicle-treated rats (51.6% of that in nonsurgically treated rats) was significantly reduced (P<.001).
|
|
|
|
Figure 5. Light micrographs of the retina at a distance of 1.5 mm from the center of the optic nerve head. A, Representative result of nonsurgically treated control, vehicle-treated, cerivastatin-treated, nitroglycerine-nitro-L-arginine methyl ester (L-NAME)treated, and L-NAME and cerivastatin-treated rats (indicated by plus and minus signs) 168 hours after reperfusion. B, Number of cells and thickness of different retinal layers 168 hours after reperfusion. Data are expressed as a percentage of nonsurgically treated control rats. Values are presented as mean ± SEM. Asterisks indicate P<.05; double asterisk indicates P<.005.
|
|
|
Destruction of the inner retinal elements was significantly suppressed in cerivastatin-treated rats compared with vehicle-treated rats. When treated with statin, the thickness of the IPL, INL, and ILM-OLM was 83.5%, 96.9%, and 92.2%, respectively, of that in nonsurgically treated rats (P<.001, P = .02, and P<.001, respectively, compared with vehicle- and surgically treated rats). The cell density of the GCL in statin-treated rats was 72.6% of that in nonsurgically treated animals (P = .01 compared with vehicle- and surgically treated rats). Regarding the thickness of the OPL and ONL, there were no statistically significant differences among the 3 groups (nonsurgically treated, vehicle-treated, and statin-treated rats).
The observed protective effects of statin were reversed by intravenous injections of L-NAME, an NOS inhibitor. Although the administration of L-NAME alone showed no significant effects compared with the vehicle-treated controls, simultaneous administration of statin and L-NAME resulted in a loss of the protective effects of statin. These data, together with the leukocyte rolling and accumulation results, indicate that statin exerts its protective effects on ischemia-reperfusion injury mainly by NO-dependent maintenance of endothelial functions.
COMMENT
To date, the mechanism of neuronal damage in retinal ischemia-reperfusion injury remains to be fully understood. Recently, considerable effort has been made to elucidate the neuropathy process, and an ischemia-reperfusion model of retinal circulation has been established. In such pathologic conditions, researchers have documented changes in endothelial function characterized by NO release and the endothelial interaction with leukocytes through leukocyte adhesion molecules.14, 24-25 For instance, leukocyte adhesion molecules are reported to be up-regulated during short-term endothelial activation caused by ischemia-reperfusion induction.24 The resulting accumulation of leukocytes in postischemic tissues has also been implicated in the pathogenesis of ischemia-reperfusion injury by producing oxygen free radicals and releasing various cytokines.26-28 Manipulation of endothelial function may be a key in controlling the severity of the injury. In fact, a recent in vivo study from our laboratory using rats with ischemia-reperfusion injury showed that the reduction of leukocyte accumulation by inhibition of ICAM-1 and P-selectin29 markedly diminished the retinal damage from transient retinal ischemia.30
In this study, we demonstrated that an HMG-CoA reductase inhibitor, statin, effectively blocked ischemia-induced leukocyte-endothelial interactions in vivo, significantly reduced P-selectin and ICAM-1 expression in the retina, and protected the retina from neuronal death. The beneficial effects of statin were abolished when it was administered together with an NOS inhibitor, L-NAME, indicating that enhanced release of NO may be involved in the action of these mechanisms. Statins are known to up-regulate eNOS expression and activate this enzyme in the systemic vasculature through phosphorylation by protein kinase B.31-33 In line with our observation, NO is reported to prevent leukocyte adhesion to the endothelium24 by repressing the up-regulation of cell adhesion molecules in the endothelial cells.14
On the other hand, conflicting results have also been reported. Previous studies have demonstrated that eNOS worsens the damage caused by ischemia-reperfusion injury.34 We cannot exclude the possibility that the additive effects of worsening due to L-NAME treatment and the protective effects of statins are caused by separated pathways. However, the prior study was based on results obtained within a limited period (96 hours), and the discrepancy may suggest that eNOS is toxic in the early ischemic stage but not in the late stage. It has previously been shown that the relatively specific inhibitor of NOS is also neuroprotective in ischemia-reperfusion injury; L-NAME is a nonspecific inhibitor of NOS, and the results of Neufeld et al35 support our conjecture.
Very recently, Weitz-Schmidt et al36 showed that several statins, including simvastatin, bind directly to lymphocyte functionassociated antigen 1 (LFA-1) and inhibit LFA-1mediated leukocyte adhesion. However, LFA-1 may not play a major role in our study. Cerivastatin did not exhibit short-term effects against leukocyte dynamics, and pravastatin inhibited leukocyte-endothelial interaction in our experiments even without any inhibitory effect against LFA-1. It seems that statin acts via an enhanced release of NO from endothelial cells and suppressed induction of leukocyte adhesion molecules to ultimately decrease leukocyte accumulation and protect the subsequent retinal injury. Further experiments are needed to establish a causal relationship.
In addition, it is possible that the methods used in our study might induce a double injury to the retina, not only transient ischemia but also axotomy. With our methods, the blood flow is completely arrested by the ligature of the optic sheath together with the intraorbital aspect of the optic nerve. It has been shown that axotomy induces the loss of approximately 40% of the retinal GCL population 7 days after its induction.37-38 In our study, cell density of the GCL in vehicle-treated rats at 7 days was 51.6% of that in nonsurgically treated rats. Although our results are similar to the earlier reports of axotomy, we think that the major retinal damage in this study was related to the ischemia-reperfusion insult. A previous study by Rosenbaum et al39 supports this conjecture: the degree of retinal injury at 7 days is similar in 2 models of retinal ischemia: high intraocular pressure and suture ligature of the optic nerve. The retinal damage and protective effects of statin in that study may be due to several mechanisms. First, as discussed previously, the effective blocking of ischemia-induced leukocyte-endothelial interactions and significant reduction of adhesion molecule expression in the retina may result in a positive neuroprotective effect via vascular action. Second, the neuroprotective effect of statin may be related to several mechanisms, such as the inhibition of a small GTPase family40 and attenuation of the inflammatory cytokine responses that accompany insult in the neuron,41 as was shown following cerebral ischemia. Although illustration of the exact mechanisms awaits further studies, our results do indicate the potential of statins as novel neuroprotective drugs.
In conclusion, we have demonstrated that statin elicits important neuroprotective effects in retinal ischemia-reperfusion injury. The neuroprotective effects are NO-dependent and are associated with the inhibition of leukocyte-endothelial interactions. Notably, systemic administration of statin was sufficiently effective at the daily clinical dose for hyperlipidemia. Statins may be developed into a valuable novel modality for neuroprotection in the retina.
AUTHOR INFORMATION
Submitted for publication March 19, 2002; final revision received July 1, 2002; accepted September 3, 2002.
This study was supported in part by Grant-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science, and Technology of Japan (Drs Honjo, Tanihara, Kiryu, Honda, and Sawamura), the Ministry of Health, Labor, and Welfare of Japan, the Organization for Pharmaceutical Safety and Research, Takeda Science Foundation, Ono Medical Research Foundation, and Mitsubishi Foundation (Dr Sawamura), Tokyo, Japan.
Corresponding author: Megumi Honjo, MD, PhD, Department of Ophthalmology and Visual Sciences, Kyoto University Graduate School of Medicine, 54 Kawahara-cho, Shogoin, Sakyo-ku, Kyoto 606-8507, Japan (e-mail: megumi{at}kuhp.kyoto-u.ac.jp).
From the Department of Ophthalmology and Visual Sciences, Kyoto University Graduate School of Medicine, Kyoto, Japan (Drs Honjo, Nishijima, Kiryu, and Honda); Department of Ophthalmology, Kumamoto University School of Medicine, Kumamoto, Japan (Dr Tanihara); Department of Ophthalmology and Visual Sciences, College of Medicine, University of Illinois at Chicago (Dr Yue); and the Department of Bioscience, National Cardiovascular Center Research Institute, and Department of Molecular Pathophysiology, Graduate School of Pharmaceutical Sciences, Osaka University, Suita, Japan (Dr Sawamura).
REFERENCES
 |  |
1. Kawai SI, Vora S, Das S, Gachie E, Becker B, Neufeld AH. Modeling of risk factors for the degeneration of retinal ganglion cells after ischemia/reperfusion in rats: effects of age, caloric restriction, diabetes, pigmentation, and glaucoma. FASEB J. 2001;15:1285-1287.
FREE FULL TEXT
2. Ghiardi GJ, Gidday JM, Roth S. The purine nucleoside adenosine in retinal ischemia-reperfusion injury. Vision Res. 1999;39:2519-2535.
FULL TEXT
|
ISI
| PUBMED
3. Tsujikawa A, Ogura Y, Hiroshiba N, Miyamoto K, Kiryu J, Honda Y. In vivo evaluation of leukocyte dynamics in retinal ischemia reperfusion injury. Invest Ophthalmol Vis Sci. 1998;39:793-800.
FREE FULL TEXT
4. Randomised trial of cholesterol lowering in 4444 patients with coronary heart disease: the Scandinavian Simvastatin Survival Study (4S). Lancet. 1994;344:1383-1389.
FULL TEXT
|
ISI
| PUBMED
5. Shephered J, Cobbe SM, Ford I, et al. Prevention of coronary heart disease with pravastatin in men with hypercholesterolemia: West of Scotland Coronary Prevention Study Group. N Engl J Med. 1995;333:1301-1307.
FREE FULL TEXT
6. Levine GN, Keaney JJF, Vita JA. Cholesterol reduction in cardiovascular disease: clinical benefit and possible mechanisms. N Engl J Med. 1995;332:512-521.
FREE FULL TEXT
7. Treasure CB, Klein JL, Weintraub WS, et al. Beneficial effects of cholesterol-lowering therapy on the coronary endothelium in patients with coronary artery disease. N Engl J Med. 1995;332:481-487.
FREE FULL TEXT
8. Delanty N, Vaughan CJ. Vascular effects of statins in stroke. Stroke. 1997;28:2315-2320.
FREE FULL TEXT
9. Sacks FM, Pfeffer MA, Moye LA, et al. The effect of pravastatin on coronary events after myocarnial infarction in patients with average cholesterol levels: Cholesterol and Recurrent Events Trial investigators. N Engl J Med. 1996;335:1001-1009.
FREE FULL TEXT
10. Lefer AM, Campbell B, Shin YK, Scalia R, Hayward R, Lefer DJ. Simvastatin preserves the ischemic-reperfused myocardium in normocholesterolemic rat hearts. Circulation. 1999;100:178-184.
FREE FULL TEXT
11. Pruefer D, Scalia R, Lefer AM. Simvastatin inhibits leukocyte-endothelial cell interactions and protects against inflammatory processes in normocholesterolemic rats. Arterioscler Thromb Vasc Biol. 1999;19:2894-2900.
FREE FULL TEXT
12. Stalker TJ, Lefer AM, Scalia R. A new HMG-CoA reductase inhibitor, rosuvastatin, exerts anti-inflammatory effects on the microvascular endothelium: the role of mevalonic acid. Br J Pharmacol. 2001;133:406-412.
FULL TEXT
|
ISI
| PUBMED
13. Hernandez-Perera O, Perez-Sala D, Navarro-Antolin J, et al. Effects of the 3-hydroxy-3-methylglutaryl-CoA reductase inhibitors, atorvastatin and simvastatin, on the expression of endothelin-1 and endothelial nitric oxide synthase in vascular endothelial cells. J Clin Invest. 1998;101:2711-2719.
ISI
| PUBMED
14. Lefer AM. Nitric oxide: nature's naturally occurring leukocyte inhibitor. Circulation. 1997;95:553-554.
FREE FULL TEXT
15. Stefansson E, Wilson CA, Schoen T, Kuwabara T. Experimental ischemia induces cell mitosis in the adult rat retina. Invest Ophthalmol Vis Sci. 1988;29:1050-1055.
FREE FULL TEXT
16. Hangai M, Yoshimura N, Yoshida M, Yabuuchi K, Honda Y. Interleukin-1 gene expression in transient retinal ischemia in the rat. Invest Ophthalmol Vis Sci. 1995;36:571-578.
FREE FULL TEXT
17. Nishiwaki H, Ogura Y, Kimura H, Kiryu J, Honda Y. Quantitative evaluation of leukocyte dynamics in retinal microcirculation. Invest Ophthalmol Vis Sci. 1995;36:123-130.
FREE FULL TEXT
18. Nishiwaki H, Ogura Y, Kimura H, Kiryu J, Miyamoto K, Matsuda N. Visualization and quantitative analysis of leukocyte dynamics in retinal microcirculation of rats. Invest Ophthalmol Vis Sci. 1996;37:1341-1347.
FREE FULL TEXT
19. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156-159.
ISI
| PUBMED
20. Kuroiwa S, Katai N, Shibuki H, et al. Expression of cell cycle-related genes in dying cells in retinal ischemic injury. Invest Ophthalmol Vis Sci. 1998;39:610-617.
FREE FULL TEXT
21. Hughes WF. Quantitation of ischemic damage in the rat retina. Exp Eye Res. 1991;53:573-582.
FULL TEXT
|
ISI
| PUBMED
22. Tsujikawa A, Ogura Y, Hiroshiba N, et al. Tacrolimus (FK506) attenuates leukocyte accumulation after transient retinal ischemia. Stroke. 1998;29:1431-1437.
FREE FULL TEXT
23. Katai N, Yoshimura N. Apoptotic retinal neuronal death by ischemia-reperfusion is executed by two distinct caspase family proteases. Invest Ophthalmol Vis Sci. 1999;40:2697-2705.
FREE FULL TEXT
24. Kubes P, Suzuki M, Granger DN. Nitric oxide: an endogenous modulator of leukocyte adhesion. Proc Natl Acad Sci U S A. 1991;88:4651-4655.
FREE FULL TEXT
25. Kubes P, Granger DN. Nitric oxide modulates microvascular permeability. Am J Physiol. 1992;262:H611-H615.
26. Zhang RL, Chopp M, Chen H, Garcia JH. Temporal profile of ischemic tissue damage, neutrophil response, and vascular plugging following permanent and transient (2H) middle cerebral artery occlusion in the rat. J Neurol Sci. 1994;125:3-10. [published correction appears in J Neurol Sci. 1994;126:96].
FULL TEXT
27. Hatchell DL, Wilson CA, Saloupis P. Neutrophils plug capillaries in acute experimental retinal ischemia. Microvasc Res. 1994;47:344-354.
FULL TEXT
|
ISI
| PUBMED
28. del-Zoppo GJ, Schmid-Schonbein GW, Mori E, Copeland BR, Chang CM. Polymorphonuclear leukocytes occlude capillaries following middle cerebral artery occlusion and reperfusion in baboons. Stroke. 1991;22:1276-1283.
FREE FULL TEXT
29. Anderson DC. The role of 2 integrins and intercellular adhesion molecule type 1 in inflammation. In: Granger DN, Schmid-Schonbein GW, eds. Physiology and Adhesion. New York, NY: Oxford University Press; 1995:3-42.
30. Tsujikawa A, Ogura Y, Hiroshiba N, Miyamoto K, Kiryu J, Honda Y. Retinal ischemia-reperfusion injury attenuated by blocking of adhesion molecules of vascular endothelium. Invest Ophthalmol Vis Sci. 1999;40:1183-1190.
FREE FULL TEXT
31. Laufs U, La Fata V, Plutzky J, Liao JK. Upregulation of endothelial nitric oxide synthetase by HMG CoA reductase inhibitors. Circulation. 1998;97:1129-1135.
FREE FULL TEXT
32. Liao JK, Zulueta JJ, Yu FS, Peng HB, Cote CG, Hassoun PM. Regulation of bovine endothelial constitutive nitric oxide synthase by oxygen. J Clin Invest. 1995;96:2661-2666.
33. Kureishi Y, Luo Z, Shiojima I, et al. The HMG-CoA reductase inhibitor simvastatin activates the protein kinase Akt and promotes angiogenesis in normocholesterolemic animals. Nat Med. 2000;6:1004-1010.
FULL TEXT
|
ISI
| PUBMED
34. Hangai M, Miyamoto K, Hiroi K, et al. Roles of constitutive nitric oxide synthase in postischemic rat retina. Invest Ophthalmol Vis Sci. 1999;40:450-458.
FREE FULL TEXT
35. Neufeld AH, Sawada A, Becker B. Inhibition of nitric-oxide synthase 2 by aminoguanidine provides neuroprotection of retinal ganglion cells in a rat model of chronic glaucoma. Proc Natl Acad Sci U S A. 1999;96:9944-9948.
FREE FULL TEXT
36. Weitz-Schmidt G, Welzenbach K, Brinkmann V, et al. Statins selectively inhibit leukocyte function antigen-1 by binding to a novel regulatory integrin site. Nat Med. 2001;7:687-692.
FULL TEXT
|
ISI
| PUBMED
37. Berkelaar M, Clarke DB, Wang YC, Bray GM, Aguayo AJ. Axotomy results in delayed death and apoptosis of retinal ganglion cells in adult rats. J Neurosci. 1994;14:4368-4374.
ABSTRACT
38. Peinado-Ramon P, Salvador M, Villegas-Perez MP, Vidal-Sanz M. Effects of axotomy and intraocular administration of NT-4, NT-3, and brain-derived neurotrophic factor on the survival of adult rat retinal ganglion cells: a quantitative in vivo study. Invest Ophthalmol Vis Sci. 1996;37:489-500.
FREE FULL TEXT
39. Rosenbaum DM, Rosenbaum PS, Singh M, et al. Functional and morphologic comparison of two methods to produce transient retinal ischemia in the rat. J Neuroophthalmol. 2001;21:62-68.
PUBMED
40. Sawada N, Itoh H, Nakao K. Novel actions of HMG-CoA reductase inhibitors (statins): vascular and cerebral protection through inhibition of small GTPase Rho [in Japanese]. Nippon Rinsho. 2001;59:2470-2475.
PUBMED
41. Vaughan CJ, Delanty N. Neuroprotective properties of statins in cerebral ischemia and stroke. Stroke. 1999;30:1969-1973.
FREE FULL TEXT
CiteULike Connotea Del.icio.us Digg Reddit Technorati Twitter
What's this?
THIS ARTICLE HAS BEEN CITED BY OTHER ARTICLES
 |
Statins Modulate Heat Shock Protein Expression and Enhance Retinal Ganglion Cell Survival after Transient Retinal Ischemia/Reperfusion In Vivo
Schmeer et al.
IOVS 2008;49:4971-4981.
ABSTRACT
| FULL TEXT
Inhibition of Laser-Induced Choroidal Neovascularization by Atorvastatin by Downregulation of Monocyte Chemotactic Protein-1 Synthesis in Mice
Yamada et al.
IOVS 2007;48:1839-1843.
ABSTRACT
| FULL TEXT
Simvastatin Elicits Dilation of Isolated Porcine Retinal Arterioles: Role of Nitric Oxide and Mevalonate-Rho Kinase Pathways
Nagaoka et al.
IOVS 2007;48:825-832.
ABSTRACT
| FULL TEXT
Effect of systemic administration of simvastatin on retinal circulation.
Nagaoka et al.
Arch Ophthalmol 2006;124:665-670.
ABSTRACT
| FULL TEXT
Chronic pre-treatment of statins is associated with the reduction of the no-reflow phenomenon in the patients with reperfused acute myocardial infarction
Iwakura et al.
Eur Heart J 2006;27:534-539.
ABSTRACT
| FULL TEXT
Neuroprotective and Blood-Retinal Barrier-Preserving Effects of Cannabidiol in Experimental Diabetes
El-Remessy et al.
Am. J. Pathol. 2006;168:235-244.
ABSTRACT
| FULL TEXT
Role of Statins in the Treatment and Prevention of Stroke: Introduction
Becker and Chopp
Stroke 2004;35:2706-2707.
FULL TEXT
HMG-CoA reductase inhibitor attenuates platelet adhesion in intestinal venules of hypercholesterolemic mice
Tailor et al.
Am. J. Physiol. Heart Circ. Physiol. 2004;286:H1402-H1407.
ABSTRACT
| FULL TEXT
Involvement of oxidative stress-induced abnormalities in ceramide and cholesterol metabolism in brain aging and Alzheimer's disease
Cutler et al.
Proc. Natl. Acad. Sci. USA 2004;101:2070-2075.
ABSTRACT
| FULL TEXT
|