 |
|
Survey of Patients With Granular, Lattice, Avellino, and Reis-Bücklers Corneal Dystrophies for Mutations in the BIGH3 and Gelsolin Genes
Nasrin A. Afshari, MD;
James E. Mullally, MS;
Mehran A. Afshari, MD, MPH;
Roger F. Steinert, MD;
Anthony P. Adamis, MD;
Dimitri T. Azar, MD;
Jonathan H. Talamo, MD;
Claes H. Dohlman, MD, PhD;
Thaddeus P. Dryja, MD
Arch Ophthalmol. 2001;119:16-22.
ABSTRACT
| |
Objectives To search for novel mutations that cause corneal stromal dystrophies
and to confirm or revise the clinical diagnosis of patients with these mutations.
Patients Through review of the records of the Cogan Eye Pathology Laboratory
at the Massachusetts Eye and Ear Infirmary, Boston, and of clinical records,
we ascertained 14 unrelated patients with the clinical or histopathologic
diagnosis of granular (3 cases), Avellino (5 cases), lattice (5 cases), or
Reis-Bücklers (1 case) corneal dystrophy.
Methods Clinical records and histopathologic findings of the index patients
and their relatives were reviewed. Patients and selected relatives donated
a blood sample from which leukocyte DNA was purified and assayed for mutations
in the BIGH3 gene and, in 2 patients, the gelsolin
gene, using the polymerase chain reaction and direct genomic sequencing.
Results All index patients with the diagnosis of granular dystrophy or Avellino
dystrophy had the missense mutation Arg555Trp or Arg124His, respectively,
previously reported in the BIGH3 gene. Of the 5 index
patients with a prior diagnosis of lattice dystrophy, 2 had the originally
reported lattice mutation (Arg124Cys) in the BIGH3
gene, 1 had a more recently reported missense mutation (His626Arg) in the
same gene, 1 had the missense mutation Asp187Asn in the gelsolin gene, and
1 had no detected mutation in either gene. Affected members of the family
with Reis-Bücklers dystrophy did not carry the previously reported mutations
Arg555Gln or Arg124Leu but instead carried a novel missense mutation Gly623Asp
in the BIGH3 gene.
Conclusions Molecular genetic analysis can improve the accuracy of diagnosis of
patients with corneal dystrophies. Two patients with a prior diagnosis of
lattice corneal dystrophy had their diagnosis changed to gelsolin-related
amyloidosis (1 case) or secondary, nonhereditary localized amyloidosis (1
case). A novel mutation in the BIGH3 gene that causes
Reis-Bücklers dystrophy was uncovered through this analysis, and another
recently reported novel mutation was encountered. These findings serve to
expand our knowledge of the spectrum of pathogenic mutations in BIGH3.
INTRODUCTION
THE STUDY by Jones and Zimmerman1 in
1961 provided a framework for the classification of granular, lattice, and
macular dystrophies of the corneal stroma according to their clinical appearance
and, in particular, their histopathologic staining patterns. Specifically,
the dominantly inherited granular and lattice dystrophies featured stromal
deposits of hyaline material that was red with the Masson trichrome stain
and amyloid material that was highlighted with the Congo red stain, respectively.
Corneas with macular dystrophy (recessively inherited) had stromas with an
abundance of mucopolysaccharides that stained with Alcian blue.1-2
Subsequent refinement of the diagnostic classification added the categories
Avellino dystrophy (a dominantly inherited disease that shares features of
both lattice and granular dystrophy),3 lattice
type II (a dominantly inherited systemic form of amyloidosis involving the
cornea, skin, kidney, and other tissues; also known as Meretoja syndrome),4 lattice type III (a late-onset dystrophy that features
amyloid deposits in the stroma and is usually inherited as a recessive trait;
it is termed lattice type IIIA when it is inherited
as a dominant trait).5-8
By 1996, genetic linkage studies had shown that the mutations responsible
for granular, lattice, and Avellino stromal dystrophies were all within the
same region of chromosome 5q, as was the gene for the subepithelial dystrophies
called Reis-Bücklers corneal dystrophy or Thiel-Behnke corneal dystrophy.9-11 The gene that causes
macular corneal dystrophy was mapped to chromosome 16q.12
Subsequent studies8, 13-14
showed that specific mutations in the BIGH3 gene
cause the stromal dystrophies linked to chromosome 5q and cause dominantly
inherited lattice corneal dystrophy type IIIA, whose gene had not been previously
mapped. Discoveries reported from 1990 to 1992 indicated that lattice type
II (Meretoja syndrome) was caused by either of 2 different missense mutations
in the gelsolin gene on chromosome band 9q34.15-18
The gene responsible for macular corneal dystrophy has recently been identified.19
Herein we report a molecular genetic analysis of the BIGH3 gene in a set of patients with clinically diagnosed corneal dystrophies.
The survey was performed to search for novel pathogenic mutations and to test
the reliability of the clinicohistopathologic diagnosis of these diseases.
REPORT OF CASES
Eleven of the 14 index patients were identified through the archives
of the Cogan Eye Pathology Laboratory at the Massachusetts Eye and Ear Infirmary,
where specimens obtained during corneal transplantation are processed. Specimens
with the diagnosis of lattice, granular, or Avellino dystrophy were reviewed.
The corresponding surgeons and subsequently the index patients were contacted
and asked to participate in the study by providing a blood sample for DNA
analysis. Three index patients ascertained through the clinical practices
of the authors had corneal dystrophies not yet treated with a transplant.
Affected and unaffected relatives of some patients were contacted and also
asked to participate in the study. Table
1 lists the sex, age at the time of the initial penetrating keratoplasty,
and the visual acuity in that eye at the time of penetrating keratoplasty.
Brief descriptions of the clinical and histologic features of these cases
follow.
|
|
|
|
Table 1. Sex, Age, and Visual Acuity at the Time of the Initial Penetrating
Keratoplasty
|
|
|
GRANULAR CORNEAL DYSTROPHY
Three index patients had granular corneal dystrophy. Two patients, GCD1
and GCD2 (pathology numbers E91-4450 and E86-177, respectively), came from
families with an inheritance pattern consistent with dominant inheritance.
GCD3 has an unknown family history and has not yet undergone penetrating keratoplasty.
On slitlamp examination, index case patients had features typical of granular
dystrophy (Figure 1A). Histopathologically, the corneas had hyaline deposits in the stroma that stained
red with the Masson trichrome stain (Figure
1B).
|
|
|
|
Figure 1. Slitlamp view (A) and histopathologic
appearance (B, Masson trichrome stain) of the cornea of patient GCD1 with
granular dystrophy. Slitlamp (C) and histopathologic appearance (D, Masson
trichrome stain; E, Congo red stain) of patient ACD2 with Avellino corneal
dystrophy. Slitlamp (F) and histopathologic appearance (G, Congo red stain)
of the patient LCD2 with lattice corneal dystrophy and the BIGH3
mutation His626Arg. Full-face view (H) of the affected uncle of patient LCD1
with lattice corneal dystrophy type II (Meretoja syndrome demonstrating lax
skin). Slitlamp (I) and histopathologic appearance (J, Congo red stain) of
index patient LCD1. Slitlamp (K) and histopathologic appearance (L, Congo
red stain) of patient LCD5 with no detected mutation in the BIGH3
and gelsolin genes. Slitlamp (M) and histopathologic appearance (N, periodic
acid–Schiff stain) of the index patient in the family with Reis-Bücklers
corneal dystrophy carrying the novel missense mutation of Gly623Asp. Unaffected
cornea (O) of the 34-year-old woman with the BIGH3 mutation Gly623Asp.
|
|
|
AVELLINO CORNEAL DYSTROPHY
Five patients had Avellino corneal dystrophy. Index patients ACD1 through
ACD3 had undergone penetrating keratoplasty (pathology numbers E86-366, S97R44231,
and S98A13291, respectively), whereas patients ACD4 and ACD5 had not as yet.
All 5 patients with Avellino dystrophy came from families with an apparently
dominant inheritance pattern. They all reported ancestors who lived in the
area surrounding Avellino, Italy. The index patients had stromal opacities
that were larger than those seen in lattice dystrophy and had snowflake shapes
(Figure 1C). Histopathologically,
the deposits stained with both the Masson trichrome stain and the Congo red
stain (Figure 1D-E).
LATTICE CORNEAL DYSTROPHY
Five index patients had lattice corneal dystrophy. Patients LCD1 through
LCD4 (pathology numbers S97D42704, E90-3246, S97F50454, and E84-999, respectively)
came from families with corneal dystrophy transmitted in an apparently dominant
inheritance pattern. They all had typical latticelike stromal deposits seen
with the slitlamp. The clinical and histopathologic findings of one of these
patients (LCD2) are shown in Figure 1F-G.
Of these 4 index cases, patient LCD1 was notable because the patient's affected
maternal uncle had the diagnosis of Ehlers-Danlos syndrome made at another
institution because of lax skin (Figure 1H); molecular genetic analysis indicated that the diagnosis of the
Ehlers-Danlos syndrome in this family was incorrect (see below). This relative
had peripheral neuropathy, but reportedly a peripheral nerve biopsy specimen
failed to show amyloid. The patient's sister and mother had similar skin abnormalities
by history. Slitlamp and histopathologic findings of the index patient are
shown in Figure 1 I-J.
The fifth case of lattice dystrophy, patient LCD5 (pathology number
S97T43634), was a 63-year-old woman with no family history of corneal dystrophy.
Bilateral corneal opacities were present since the age of 5 years by history.
The stromal deposits were diffuse and without lattice lines (Figure 1K). Histopathologically, the corneal stroma had numerous
congophilic deposits that showed birefringence and dichroism and were interpreted
as consistent with lattice dystrophy (Figure
1L).
REIS-BÜCKLERS CORNEAL DYSTROPHY
One patient had Reis-Bücklers corneal dystrophy. The index patient
RBCD1 (pathology number E92-2215) had a history of recurrent painful corneal
erosions since childhood. There were subepithelial corneal opacities in a
geographic pattern. Histopathologically, Bowman's layer was disrupted with
fibrous tissue and hyaline deposits that did not stain with periodic acid–Schiff
stain or with the Masson trichrome or Congo red stains. Slitlamp and histopathologic
findings are shown in Figure 1M-N.
METHODS
This study conformed to the Declaration of Helsinki regarding the enrollment
of human subjects. Phlebotomy was performed according to standard methods
to obtain 10 to 30 mL of venous blood from participating subjects. Leukocyte
DNA was purified using proteinase K digestion followed by chloroform and phenol
extractions and ethanol precipitation.
The exons of the BIGH3 gene and in 2 patients
the gelsolin gene were amplified from leukocyte DNA using the polymerase chain
reaction. We evaluated first the exons containing codons 124 and 555, where
the originally reported BIGH3 mutations are located.
If no mutations were found in these regions, the remainder of the coding sequence
was evaluated by direct sequencing. The oligonucleotide primers used for the
polymerase chain reaction were those reported by Munier et al,13
with the exception of exons 1, 2, 8, 13, and 17. The primer pairs used to
amplify these exons were, respectively (sense/antisense; 5'-3'):
GCGCTCTCACTTCCCTGGAG/GACTACCTGACCTTCCGCAG, GGTGGACGTGCTGATCATCT/AGCCAGCGTGCATACAGCTT,
CTTGACCTGAGTCTGTTTGG/GAAGTCGCCCAAAGATCTCT, GGGATTAACTCTATCTCCTT/TGTGTATAATTCCATCCTGG,
and GGGAGATCTGCACCTATTTG/TGGTGCATTCCTCCTGTAGT. The primer pair used to amplify
nucleotides 565 through 680 of the gelsolin gene was reported by de la Chapelle
et al.18
Amplified DNA fragments were sequenced directly according to the protocols
accompanying the Thermo Sequenase cycle sequencing kit (United States Biochemical,
Cleveland, Ohio) and using dideoxynucleotide triphosphates that were  -labeled
with phosphorus 33.
RESULTS
All 3 index patients with the clinicohistopathologic diagnosis of granular
dystrophy, as well as 2 affected relatives of these patients who participated
in this study, had the missense mutation Arg555Trp (CGC to TGG) in the BIGH3 gene. None of the unaffected relatives of these patients
was analyzed. All 5 index patients with Avellino dystrophy (ACD1-ACD5) and
3 of their affected relatives had the missense mutation Arg124His (CGC to
CAC) in the same gene. None of the unaffected relatives of these patients
was analyzed.
Of the 5 index patients with a prior diagnosis of lattice dystrophy,
patients LCD3 and LCD4 had the missense mutation Arg124Cys (CGC to TGC) in
the BIGH3 gene. One affected relative of one of these
patients was analyzed and was found also to carry this mutation, whereas one
unaffected relative who was analyzed did not.
Patients LCD1, LCD2, and LCD5 with clinically diagnosed lattice dystrophy
had none of the reported mutations affecting codons 555 and 124, so the entire
coding sequence of the BIGH3 gene was analyzed. Patient
LCD2 (Figure 1F-G)
heterozygously carried the missense mutation His626Arg (CAT to CGT). A schematic
pedigree of the family of this patient is shown in Figure 2. Of 10 affected relatives who were analyzed (individuals
II:15, II:17, III:3, III:6, III:7, III:8, III:10, III:11, IV:1, and IV:2),
all carried this same mutation heterozygously. Of 2 unaffected relatives who
were analyzed (individuals II:19 and IV:4), 1 carried the mutation and 1 did
not. The unaffected carrier (individual IV:4) was 34 years old at the time
of the last ocular examination. A slitlamp photograph of the cornea of this
patient is shown in Figure 1.
|
|
|
|
Figure 2. Schematic pedigree of the family
with lattice corneal dystrophy and the His626Arg missense mutation (top) and
the family with Reis-Bücklers dystrophy and the Gly623Asp mutation (bottom).
Arrows point to the index cases. Filled symbols indicate affected individuals.
Beneath the symbols of individuals whose DNA was analyzed are
their BIGH3 genotypes.
|
|
|
In patients LCD1 and LCD5, no sequence changes that would alter the
primary structure of BIGH3 were found. Subsequently,
the sequence of codon 187 of the gelsolin gene was determined in these 2 patients.
In patient LCD1, the missense mutation Asp187Asn (GAC to AAC) was found in
the gelsolin gene, a mutation previously reported to cause gelsolin-related
amyloidosis (Meretoja syndrome).15-18
Analysis of DNA from the index patient's affected sister showed that she also
carried this mutation heterozygously. We did not analyze the DNA from any
other relative in this family. The full-face photograph of the index patient's
affected maternal uncle is shown in Figure
1H.
Patient LCD5 had no mutation in the coding sequence of the BIGH3 gene and no mutation of codon 187 in the gelsolin gene. In view
of these findings and the negative family history, and because the patient's
history and slitlamp findings were atypical for lattice dystrophy, this patient's
diagnosis was changed to presumed secondary amyloidosis.
The index patient RBCD1 with Reis-Bücklers corneal dystrophy, a
70-year-old woman, had no defect in the sequence of codons 124 or 555 of the BIGH3 gene. A subsequent determination of the entire BIGH3 coding sequence revealed the missense change Gly623Asp
(GGC to GAT) (Figure 3). The patient's
affected 89-year-old aunt (I:4) and this aunt's affected 54-year-old son (II:10)
also carried the same mutation (see Figure
2 for pedigree). The deceased mother of the index patient was affected
by history. DNA from 2 unaffected relatives was also evaluated: a 65-year-old
sister (individual II:4) who did not carry this mutation and a 64-year-old
maternal cousin (individual II:6) of the index patient who carried this missense
mutation. This mutation was not found among a screen of 95 unrelated, healthy
control individuals.
|
|
|
|
Figure 3. DNA sequence around codon 623
of the BIGH3 gene in the index patient RBCD1 (E92-2215) with
Reis-Bücklers dystrophy and an unaffected control individual. The patient
is heterozygous with both the wild-type sequence of codon 623 (GGC), specifying
glycine, and a mutant sequence (GAT), specifying aspartic acid.
|
|
|
COMMENT
The diagnosis of hereditary corneal dystrophies is customarily based
on slitlamp and histopathologic findings. Until the identification of the
responsible genes, there was no way to test the accuracy of the clinicopathologic
diagnosis. Particularly disconcerting were patients with equivocal or ambiguous
findings. Examples were cases with clinical and histopathologic features of
both granular and lattice dystrophy (cases now categorized as Avellino dystrophy)3 and cases with features of both granular and Reis-Bücklers
dystrophy.20 The identification of the gene
defects responsible for most of the corneal dystrophies provides precision
to the diagnosis.
Our study demonstrates the diagnostic value of molecular genetic analysis
of patients with corneal dystrophies. In 2 cases, DNA analysis altered the
prior diagnosis based on clinical and histopathologic findings. In 1 case
(LCD1), the patient and some affected relatives had the clinicopathologic
diagnosis of lattice dystrophy type I. Lax skin in some affected relatives
prompted the additional diagnosis of Ehlers-Danlos syndrome that was presumed
to be fortuitously present. Our identification of a mutation in the gelsolin
gene provided the correct diagnosis, Meretoja syndrome, which explained both
the ocular and systemic disease in the affected family members. In a second
case, DNA analysis failed to uncover a mutation in either the BIGH3 or gelsolin gene. Subsequent review of the clinical findings
suggested that the corneal amyloid deposits were secondary to a corneal disease
of uncertain etiology that occurred in childhood.
The original report13 of mutations in
the BIGH3 gene associated each of 4 corneal dystrophies
(granular, lattice, Avellino, and Reis-Bücklers) with its own causative
mutation. All subsequently described patients with granular or Avellino dystrophy
have had the originally reported BIGH3 mutations
(Table 2 and Figure 4), suggesting that these clinically defined entities are
genetically homogeneous. This is not true for lattice and Reis-Bücklers
dystrophies. Although new cases with the originally reported lattice and Reis-Bücklers
mutations have been found by other groups, additional mutations in BIGH3 have also been encountered (Table 2). Our analysis adds to the multiplicity of mutations that
can cause Reis-Bücklers dystrophy, because our patient carried a novel
mutation in the BIGH3 gene. This mutation, Gly623Asp,
is 3 codons away from the reported mutation, His626Arg,28-29
causing lattice corneal dystrophy. Gly623Asp is the fourth mutation reported
so far to be associated with Reis-Bücklers dystrophy (Table 2).13, 30, 32
Although one individual who carries the Gly623Asp mutation has not exhibited
disease at the age of 64 years, it is nevertheless likely that the mutation
is pathogenic, because no other mutation in the coding region of the BIGH3 gene was found in the index patient and because the
identified mutation was present in all affected relatives examined. Furthermore,
the Gly623Asp change has never been previously reported among patients or
healthy controls, and we did not find it in our screening of 95 healthy controls
(190 chromosomes). With regard to the unaffected Gly623Asp carrier, it is
possible that this patient will develop subepithelial opacities later in life
or he may be an example of reduced penetrance of a BIGH3 mutation. To our knowledge, there are no prior examples of reduced
penetrance for dominant BIGH3 mutations.
|
|
|
|
Table 2. Reported Mutations in the BIGH3 Gene
Associated With Granular, Lattice, Avellino, and Reis-Bücklers Corneal
Dystrophies
|
|
|
|
|
|
|
Figure 4. Schematic diagram of the primary
structure of keratoepithelin, the protein product of the BIGH3
gene (modified from Munier et al13). D1 to
D4 represent homologous domains that contain 2 highly conserved repeats designated
R and r. Arg-Gly-Asp is a recognition sequence for integrins. Below the diagrams
are the locations of the mutations described in this article or previously
reported mutations that are associated with granular, Avellino, lattice, and
Reis-Bücklers corneal dystrophies.
|
|
|
We found another possible example of reduced severity vs incomplete
penetrance in the family of index patient LCD2 with lattice corneal dystrophy
and the mutation His626Arg. A 34-year-old woman in this family (relative IV:4
of patient LCD2) carried this mutation but was asymptomatic and had no corneal
deposits seen by slitlamp examination. The affected members of 3 previously
reported families with His626Arg mutation exhibited a late disease onset,
with symptoms in some cases not arising until the fourth or fifth decade of
life.28-29 Considering these reports,
one might predict that our 34-year-old asymptomatic carrier will develop lattice
dystrophy later in life.
The function of the BIGH3 protein in the cornea is unknown, but its
primary sequence (683 amino acids) has features suggesting a role in cell
adhesion, perhaps through binding to integrins.33
It is normally produced by the corneal epithelium33-34
and resides in the stroma, particularly in Bowman's layer.35
The protein or degradation products thereof are found in the stromal and subepithelial
deposits that characterize granular, lattice, Avellino, and Reis-Bücklers
dystrophies.34-36
To date, all reported pathogenic mutations in the BIGH3 gene result in the change or deletion of a single amino acid in the
encoded protein (Table 2 and Figure 4). We have only a rudimentary knowledge
of the protein product of the BIGH3 gene, so it remains
unclear how the structures of the mutant protein products form the corneal
deposits of various shapes and histopathologic staining patterns.
Although the BIGH3 mutations causing lattice
type I, granular, Avellino, and Reis-Bücklers dystrophies are referred
to as dominant alleles, at least 2 of them are actually semidominant. Patients
who are homozygous for the Avellino (Arg124His)21-22
or granular (Arg555Trp)24 mutations have been
identified, and they are more severely affected than heterozygotes, with visually
debilitating corneal deposits appearing within the first decade of life and
recurring soon after corneal transplantation. It is not known whether the
mutations causing lattice type I and Reis-Bücklers dystrophy are semidominant,
since homozygotes have not been reported.
AUTHOR INFORMATION
Accepted for publication June 23, 2000.
This study was supported by grant EY08683 from the National Eye Institute,
Bethesda, Md, and by gifts to the Ocular Molecular Genetics Institute and
the Taylor R. Smith Laboratory. Dr Dryja is a Research to Prevent Blindness
senior scientific investigator.
Corresponding author and reprints: Thaddeus P. Dryja, MD, Massachusetts
Eye and Ear Infirmary, 243 Charles St, Boston, MA 02114 (e-mail: dryja{at}helix.mgh.harvard.edu).
From the Department of Ophthalmology (Drs N. A. Afshari, M. A. Afshari,
Steinert, Adamis, Azar, Talamo, Dohlman, and Dryja), Harvard Medical School
and the Ocular Molecular Genetics Institute (Mr Mullally and Dr Dryja), Massachusetts
Eye and Ear Infirmary, Boston.
REFERENCES
| |
1. Jones ST, Zimmerman LE. Histopathologic differentiation of granular, macular, and lattice dystrophies
of the cornea. Am J Ophthalmol. 1961;51:394-410.
ISI
| PUBMED
2. Jones ST, Zimmerman LE. Macular dystrophy of the cornea (Groenouw type II). Am J Ophthalmol. 1959;47:1-16.
ISI
| PUBMED
3. Folberg R, Alfonso E, Croxatto JO, et al. Clinically atypical granular corneal dystrophy with pathologic features
of lattice-like amyloid deposits: a study of three families. Ophthalmology. 1988;95:46-51.
ISI
| PUBMED
4. Meretoja J. Familial systemic paramyloidosis with lattice dystrophy of the cornea,
progressive cranial neuropathy, skin changes and various internal symptoms. Ann Clin Res. 1969;1:314-324.
PUBMED
5. Hida T, Tsubota K, Kigasawa K, Murata H, Ogata T, Akiya S. Clinical features of a newly recognized type of lattice corneal dystrophy. Am J Ophthalmol. 1987;104:241-248.
ISI
| PUBMED
6. Hida T, Proia AD, Kigasawa K, et al. Histopathologic and immunochemical features of lattice corneal dystrophy
type III. Am J Ophthalmol. 1987;104:249-254.
ISI
| PUBMED
7. Stock EL, Feder RS, O'Grady RB, Sugar J, Roth SI. Lattice corneal dystrophy type IIIA: clinical and histopathologic correlations. Arch Ophthalmol. 1991;109:354-358.
ABSTRACT
8. Yamamoto S, Okada M, Tsujikawa M, et al. A kerato-epithelin ( ig-h3) mutation in lattice corneal dystrophy
type IIIA. Am J Hum Genet. 1998;62:719-722.
FULL TEXT
|
ISI
| PUBMED
9. Eiberg H, Moller HU, Berendt I, Mohr J. Assignment of granular corneal dystrophy Groenouw type I (CDGG1) to
chromosome 5q. Eur J Hum Genet. 1994;2:132-138.
PUBMED
10. Stone EM, Mathers WD, Rosenwasser GOD, et al. Three autosomal dominant corneal dystrophies map to chromosome 5q. Nat Genet. 1994;6:47-51.
FULL TEXT
|
ISI
| PUBMED
11. Small KW, Mullen L, Barletta J, et al. Mapping of Reis-Bücklers' corneal dystrophy to chromosome 5q. Am J Ophthalmol. 1996;121:384-390.
ISI
| PUBMED
12. Vance JM, Jonasson F, Lennon F, et al. Linkage of a gene for macular corneal dystrophy to chromosome 16. Am J Hum Genet. 1996;58:757-762.
ISI
| PUBMED
13. Munier FL, Korvatska E, Djemaï A, et al. Kerato-epithelin mutations in four 5q31-linked corneal dystrophies. Nat Genet. 1997;15:247-251.
FULL TEXT
|
ISI
| PUBMED
14. Fujiki K, Hotta Y, Nakayasu K, et al. A new L527R mutation of the IGH3 gene in patients with lattice
corneal dystrophy with deep stromal opacities. Hum Genet. 1998;103:286-289.
FULL TEXT
|
ISI
| PUBMED
15. Maury CPJ, Kere J, Tolvanen R, de la Chapelle A. Finnish hereditary amyloidosis is caused by a single nucleotide substitution
in the gelsolin gene. FEBS Lett. 1990;276:75-77.
FULL TEXT
|
ISI
| PUBMED
16. Levy E, Haltia M, Fernandez-Madrid I, et al. Mutation in gelsolin gene in Finnish hereditary amyloidosis. J Exp Med. 1990;172:1865-1867.
FREE FULL TEXT
17. Gorevic PD, Munoz PC, Gorgone G, et al. Amyloidosis due to a mutation of the gelsolin gene in an American family
with lattice corneal dystrophy type II. N Engl J Med. 1991;325:1780-1785.
ISI
| PUBMED
18. de la Chapelle A, Tolvanen R, Boysen G, et al. Gelsolin-derived familial amyloidosis caused by asparagine or tyrosine
substitution for aspartic acid at residue 187. Nat Genet. 1992;2:157-160.
FULL TEXT
|
ISI
| PUBMED
19. Akama TO, Nishida K, Nakayama J, et al. Macular corneal dystrophy type I and type II are caused by distinct
mutations in a new sulphotransferase gene. Nat Genet. 2000;26:237-241.
FULL TEXT
|
ISI
| PUBMED
20. Møller HU. Granular corneal dystrophy Groenouw type I (GrI) and Reis-Bücklers'
corneal dystrophy (R-B): one entity? Acta Ophthalmol (Copenh). 1989;67:678-684.
21. Fujiki K, Hotta Y, Nakayasu K, Kanai A. Homozygotic patient with ig-h3 gene
mutation in granular dystrophy. Cornea. 1998;17:288-292.
FULL TEXT
|
ISI
| PUBMED
22. Okada M, Yamamoto S, Inoue Y, et al. Severe corneal dystrophy phenotype caused by homozygous R124H keratoepithelin
mutations. Invest Ophthalmol Vis Sci. 1998;39:1947-1953.
FREE FULL TEXT
23. Korvatska E, Munier FL, Djemaï A, et al. Mutation hot spots in 5q31-linked dystrophies. Am J Hum Genet. 1998;62:320-324.
FULL TEXT
|
ISI
| PUBMED
24. Okada M, Yamamoto S, Watanabe H, et al. Granular corneal dystrophy with homozygous mutations in the kerato-epithelin
gene. Am J Ophthalmol. 1998;126:169-176.
FULL TEXT
|
ISI
| PUBMED
25. Gupta SK, Hodge WG, Damji KF, Guernsey DL, Neumann PE. Lattice corneal dystrophy type 1 in a Canadian kindred is associated
with the Arg124->Cys mutation in the kerato-epithelin gene. Am J Ophthalmol. 1998;125:547-549.
FULL TEXT
|
ISI
| PUBMED
26. Meins M, Kohlhaas M, Richard G, Gal A. Type I lattice corneal dystrophy: clinical and molecular genetic study
of a large family. Klin Monatsbl Augenheilkd. 1998;212:154-158.
PUBMED
27. Endo S, Ha NT, Fujiki K, et al. Leu518Pro mutation of the ig-h3 gene
causes lattice corneal dystrophy type I. Am J Ophthalmol. 1999;128:104-106.
FULL TEXT
|
ISI
| PUBMED
28. Stewart H, Balck GC, Donnai D, et al. A mutation within exon 14 of the TGFBI causes an asymmetric, late-onset
form of lattice corneal dystrophy. Ophthalmology. 1999;106:964-970.
FULL TEXT
|
ISI
| PUBMED
29. Schmitt-Bernard C, Guittard C, Arnaud B, et al. BIGH3 exon 14 mutations lead to intermediate type I/IIIA of lattice
corneal dystrophies. Invest Ophthalmol Vis Sci. 2000;41:1302-1308.
FREE FULL TEXT
30. Okada M, Yamamoto S, Tsujikawa M, et al. Two distinct kerato-epithelin mutations in Reis-Bücklers corneal
dystrophy. Am J Ophthalmol. 1998;126:535-542.
FULL TEXT
|
ISI
| PUBMED
31. Mashima Y, Nakamura Y, Noda K, et al. A novel mutation at codon 124 (R124L) in the BIGH3 gene is associated
with a superficial variant of granular corneal dystrophy. Arch Ophthalmol. 1999;117:90-93.
FREE FULL TEXT
32. Rozzo C, Fossarello M, Galleri G, et al. A common big-h3 gene mutation (DelF540) in a large cohort of Sardinian
Reis Bücklers corneal dystrophy patients. Hum Mutat. 1998;12:215-216.
PUBMED
33. Escribano J, Hernando N, Ghosh S, Crabb J, Coca-Prados M. cDNA from human ocular ciliary epithelium homologous to ig-h3
is preferentially expressed as an extracellular protein in the corneal epithelium. J Cell Physiol. 1994;160:511-521.
FULL TEXT
|
ISI
| PUBMED
34. Takacs L, |
